Incidental Mutation 'R8025:Itih5'
ID 617622
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8025 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 10241022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 641 (A641T)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: A641T

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: A641T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Actl7b T C 4: 56,741,137 T74A probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dennd1b A G 1: 139,110,420 K267E Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr716 A G 7: 107,147,723 M136V possibly damaging Het
Olfr869 T C 9: 20,137,632 V172A probably benign Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Pcsk5 T A 19: 17,561,051 probably benign Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rbpjl C A 2: 164,410,246 probably benign Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Recql5 C A 11: 115,928,112 L209F probably damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33a T C 5: 123,558,675 N305S possibly damaging Het
Vps33b A T 7: 80,290,346 probably benign Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
R9744:Itih5 UTSW 2 10251410 missense probably damaging 1.00
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGAGCGACTTTGGAGCTAC -3'
(R):5'- ATCTGGTGACTGTGCCTTTC -3'

Sequencing Primer
(F):5'- ACTTTGGAGCTACCTCACTGTGAAG -3'
(R):5'- ACTGTGCCTTTCATATAGGGTC -3'
Posted On 2020-01-23