Incidental Mutation 'R8025:Itih5'
ID 617622
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 067464-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8025 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 10245833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 641 (A641T)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: A641T

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: A641T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,536,635 (GRCm39) L51R probably damaging Het
Actl7b T C 4: 56,741,137 (GRCm39) T74A probably damaging Het
Aip C A 19: 4,165,346 (GRCm39) A207S probably benign Het
AL732309.1 A G 2: 25,136,331 (GRCm39) probably benign Het
Apcdd1 G T 18: 63,069,979 (GRCm39) C82F probably damaging Het
Arhgap42 T G 9: 9,005,823 (GRCm39) I736L probably benign Het
Baz1a A T 12: 54,955,921 (GRCm39) I1056N probably benign Het
Bzw2 T C 12: 36,157,517 (GRCm39) E316G probably damaging Het
Carns1 A T 19: 4,216,505 (GRCm39) I559N probably damaging Het
Chrnb2 A T 3: 89,668,649 (GRCm39) V222E probably damaging Het
Cngb3 A T 4: 19,280,960 (GRCm39) N10Y possibly damaging Het
Dennd1b A G 1: 139,038,158 (GRCm39) K267E Het
Dhx32 A G 7: 133,323,100 (GRCm39) Y705H probably damaging Het
Dnah7c G A 1: 46,496,456 (GRCm39) V114I probably benign Het
Dnah8 T A 17: 30,960,311 (GRCm39) C2229* probably null Het
Dync2i2 T C 2: 29,938,730 (GRCm39) Q51R probably benign Het
Gm14401 T C 2: 176,778,249 (GRCm39) F112L probably damaging Het
Gm57858 C A 3: 36,073,136 (GRCm39) R382L probably damaging Het
Habp4 G A 13: 64,322,645 (GRCm39) R238H probably benign Het
Herpud1 A G 8: 95,119,149 (GRCm39) Y301C probably damaging Het
Kcns3 A T 12: 11,141,846 (GRCm39) N284K probably damaging Het
Mcrs1 G A 15: 99,144,814 (GRCm39) Q267* probably null Het
Midn G A 10: 79,991,126 (GRCm39) A379T probably benign Het
Muc21 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,931,879 (GRCm39) probably benign Het
Odad2 A T 18: 7,127,224 (GRCm39) N996K probably benign Het
Or2d36 A G 7: 106,746,930 (GRCm39) M136V possibly damaging Het
Or4d2b A T 11: 87,779,777 (GRCm39) probably null Het
Or51f5 T C 7: 102,424,463 (GRCm39) V244A probably benign Het
Or5m11 A T 2: 85,781,856 (GRCm39) I150F probably benign Het
Or7e175 T C 9: 20,048,928 (GRCm39) V172A probably benign Het
Parpbp T C 10: 87,928,970 (GRCm39) D490G probably benign Het
Pcbp2 T A 15: 102,396,711 (GRCm39) S262R probably benign Het
Pcdhgc5 T C 18: 37,953,992 (GRCm39) I422T possibly damaging Het
Pcsk5 T A 19: 17,538,415 (GRCm39) probably benign Het
Plxna1 G A 6: 89,308,254 (GRCm39) R1278W probably damaging Het
Polr1c A G 17: 46,555,974 (GRCm39) L162P probably damaging Het
Rasl2-9 A G 7: 5,128,481 (GRCm39) S150P probably damaging Het
Raver2 C A 4: 100,960,162 (GRCm39) S214* probably null Het
Rbpjl C A 2: 164,252,166 (GRCm39) probably benign Het
Rec114 T G 9: 58,567,605 (GRCm39) E127A possibly damaging Het
Recql5 C A 11: 115,818,938 (GRCm39) L209F probably damaging Het
Rgs11 T C 17: 26,423,359 (GRCm39) probably null Het
Rgs3 C A 4: 62,608,831 (GRCm39) H366N probably damaging Het
Rnf148 C T 6: 23,654,196 (GRCm39) D267N possibly damaging Het
Scn1a T C 2: 66,148,557 (GRCm39) N1007S probably benign Het
Sdcbp A G 4: 6,393,022 (GRCm39) T220A probably benign Het
Sema5a A G 15: 32,548,928 (GRCm39) N134S probably benign Het
Smg1 G A 7: 117,806,212 (GRCm39) Q210* probably null Het
Snx7 A G 3: 117,626,526 (GRCm39) V328A probably benign Het
Sult1c2 A T 17: 54,138,837 (GRCm39) S247T probably benign Het
Tceanc2 C T 4: 106,996,997 (GRCm39) probably null Het
Tead3 T C 17: 28,554,009 (GRCm39) D141G probably benign Het
Tlcd5 T A 9: 43,022,848 (GRCm39) T169S probably benign Het
Ube3b T C 5: 114,546,270 (GRCm39) M692T probably damaging Het
Vmn1r188 T C 13: 22,272,084 (GRCm39) F13L probably benign Het
Vmn2r3 A G 3: 64,182,871 (GRCm39) V276A possibly damaging Het
Vmn2r57 A G 7: 41,076,183 (GRCm39) I443T probably benign Het
Vps33a T C 5: 123,696,738 (GRCm39) N305S possibly damaging Het
Vps33b A T 7: 79,940,094 (GRCm39) probably benign Het
Wdr72 T A 9: 74,050,781 (GRCm39) M91K probably benign Het
Xylb T C 9: 119,210,569 (GRCm39) F351L probably damaging Het
Zan C T 5: 137,404,614 (GRCm39) D3883N unknown Het
Zfp82 T A 7: 29,756,278 (GRCm39) H268L probably damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGAGCGACTTTGGAGCTAC -3'
(R):5'- ATCTGGTGACTGTGCCTTTC -3'

Sequencing Primer
(F):5'- ACTTTGGAGCTACCTCACTGTGAAG -3'
(R):5'- ACTGTGCCTTTCATATAGGGTC -3'
Posted On 2020-01-23