Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Acvr2b'

694905

Institutional Source

Beutler Lab

Gene Symbol

Acvr2b

Ensembl Gene

ENSMUSG00000061393

Gene Name

activin receptor IIB

Synonyms

ActRIIB

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119402118-119434995 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119428050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 115 (H115L)

Ref Sequence

ENSEMBL: ENSMUSP00000150566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035093] [ENSMUST00000165044] [ENSMUST00000215746]

AlphaFold

P27040

Predicted Effect

probably damaging
Transcript: ENSMUST00000035093
AA Change: H115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035093
Gene: ENSMUSG00000061393
AA Change: H115L

Domain	Start	End	E-Value	Type
Pfam:Activin_recp	27	117	5.4e-13	PFAM
transmembrane domain	130	152	N/A	INTRINSIC
Pfam:Pkinase	206	494	1.5e-55	PFAM
Pfam:Pkinase_Tyr	206	494	2.3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165044
AA Change: H115L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000126108
Gene: ENSMUSG00000061393
AA Change: H115L

Domain	Start	End	E-Value	Type
Pfam:Activin_recp	27	117	5.3e-14	PFAM
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Pkinase_Tyr	214	502	1.7e-26	PFAM
Pfam:Pkinase	217	501	1e-31	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215746
AA Change: H115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1200

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene show abnormal lateral asymmetry and homeotic transformation of the axial skeleton, and die shortly after birth with extensive cardiac defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Acvr2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01662:Acvr2b	APN	9	119432504	missense	probably damaging	1.00
IGL02206:Acvr2b	APN	9	119427998	nonsense	probably null
IGL03022:Acvr2b	APN	9	119427521	missense	probably benign	0.10
IGL03131:Acvr2b	APN	9	119431284	missense	possibly damaging	0.92
R0455:Acvr2b	UTSW	9	119432609	missense	probably damaging	1.00
R2131:Acvr2b	UTSW	9	119432808	missense	probably damaging	1.00
R4744:Acvr2b	UTSW	9	119431262	missense	probably damaging	1.00
R5278:Acvr2b	UTSW	9	119432489	missense	probably damaging	0.99
R5636:Acvr2b	UTSW	9	119428309	missense	probably damaging	1.00
R6196:Acvr2b	UTSW	9	119433403	missense	possibly damaging	0.71
R6253:Acvr2b	UTSW	9	119428561	missense	probably damaging	1.00
R6424:Acvr2b	UTSW	9	119402579	missense	probably benign
R6465:Acvr2b	UTSW	9	119433303	missense	probably damaging	1.00
R7096:Acvr2b	UTSW	9	119428189	splice site	probably null
R7102:Acvr2b	UTSW	9	119432553	missense	probably damaging	0.96
R7497:Acvr2b	UTSW	9	119433286	missense	probably benign
R8557:Acvr2b	UTSW	9	119432588	missense	probably damaging	0.98
R9041:Acvr2b	UTSW	9	119427986	nonsense	probably null
R9276:Acvr2b	UTSW	9	119402550	missense	probably benign	0.23
R9321:Acvr2b	UTSW	9	119428285	missense	probably benign	0.01
R9340:Acvr2b	UTSW	9	119428426	missense	probably damaging	0.98
R9531:Acvr2b	UTSW	9	119431326	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGATGTTTCTGAAGCTGCG -3'
(R):5'- GATACATCCAGAAGGCCAGC -3'

Sequencing Primer
(F):5'- GTTTCTGAAGCTGCGCTGCC -3'
(R):5'- CGATGAGAGAGAGGCCTCC -3'

Posted On

2022-01-20