Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Ash1l'

694868

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik

MMRRC Submission

Accession Numbers

Genbank: NM_138679; MGI: 2183158

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88950622-89079375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89007223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1720 (H1720L)

Ref Sequence

ENSEMBL: ENSMUSP00000088451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090933
AA Change: H1720L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: H1720L

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186583
AA Change: H1720L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: H1720L

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88981712	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	89007736	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	89035236	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	89072484	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88984635	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	89063902	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88983529	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	89066265	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88985506	nonsense	probably null
IGL02326:Ash1l	APN	3	88966057	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	89072548	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88985565	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	89069079	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	89066218	nonsense	probably null
IGL02727:Ash1l	APN	3	89023037	missense	probably benign
IGL02732:Ash1l	APN	3	88966228	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88984801	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88984181	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	89035268	splice site	probably benign
IGL03253:Ash1l	APN	3	88984674	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	89023083	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	89007220	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88966326	missense	probably benign
BB008:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	89058589	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88983459	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88982277	missense	probably benign
R0543:Ash1l	UTSW	3	89063778	splice site	probably null
R0855:Ash1l	UTSW	3	89054454	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	89035263	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88983316	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88984897	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	89007352	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88985052	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	89058499	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	89072476	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	89067242	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	89076224	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88965984	missense	probably benign
R1793:Ash1l	UTSW	3	89070309	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88981555	missense	probably benign	0.00
R1909:Ash1l	UTSW	3	88984528	missense	probably benign	0.29
R1938:Ash1l	UTSW	3	88984422	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	89066317	missense	probably benign	0.00
R2070:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2071:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88985295	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	89066298	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	89007367	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	89026426	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	89054386	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88982260	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88981966	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	89066415	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	89007199	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88985315	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	89072476	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88982845	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88985334	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	89058634	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88982323	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	89023212	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	89052877	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	89066275	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88982394	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88984876	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88981426	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	89023185	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88985609	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	89007607	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	89051990	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	89054498	missense	possibly damaging	0.83
R5719:Ash1l	UTSW	3	89058626	missense	probably damaging	1.00
R5839:Ash1l	UTSW	3	88983351	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	89068993	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88981584	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88984036	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	89053143	nonsense	probably null
R6110:Ash1l	UTSW	3	88985129	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	89052773	nonsense	probably null
R6200:Ash1l	UTSW	3	89070527	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88982761	nonsense	probably null
R6331:Ash1l	UTSW	3	89007865	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88983780	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88985061	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	89052037	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	89076113	missense	probably benign	0.00
R6843:Ash1l	UTSW	3	88985388	missense	probably damaging	1.00
R6894:Ash1l	UTSW	3	88982991	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88981657	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88982671	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88985340	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88983457	frame shift	probably null
R7150:Ash1l	UTSW	3	89077074	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	89070509	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	89054634	splice site	probably null
R7288:Ash1l	UTSW	3	88965892	start gained	probably benign
R7319:Ash1l	UTSW	3	88981387	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88981759	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88965997	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88983865	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	89043193	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	89007264	missense	probably benign
R7857:Ash1l	UTSW	3	88984309	nonsense	probably null
R7889:Ash1l	UTSW	3	88966038	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88983625	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	89070317	nonsense	probably null
R7973:Ash1l	UTSW	3	89052857	missense	probably benign
R8119:Ash1l	UTSW	3	89035427	missense	probably damaging	1.00
R8157:Ash1l	UTSW	3	89063707	critical splice donor site	probably null
R8162:Ash1l	UTSW	3	89070246	missense	probably damaging	0.99
R8194:Ash1l	UTSW	3	89052755	missense	probably damaging	1.00
R8306:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	89007644	missense	probably benign	0.02
R8558:Ash1l	UTSW	3	88984406	missense	probably damaging	0.96
R8744:Ash1l	UTSW	3	89058583	missense	possibly damaging	0.89
R8923:Ash1l	UTSW	3	88985667	missense	possibly damaging	0.51
R8969:Ash1l	UTSW	3	88966291	missense	possibly damaging	0.52
R8970:Ash1l	UTSW	3	89069000	missense	probably benign	0.00
R9002:Ash1l	UTSW	3	88981408	missense	probably benign	0.17
R9023:Ash1l	UTSW	3	88985269	missense	probably damaging	1.00
R9032:Ash1l	UTSW	3	88981987	missense	probably benign	0.19
R9032:Ash1l	UTSW	3	88984222	missense	probably benign	0.00
R9049:Ash1l	UTSW	3	89007364	missense	probably benign
R9085:Ash1l	UTSW	3	88981987	missense	probably benign	0.19
R9085:Ash1l	UTSW	3	88984222	missense	probably benign	0.00
R9130:Ash1l	UTSW	3	89058541	nonsense	probably null
R9294:Ash1l	UTSW	3	88982990	missense	possibly damaging	0.90
R9365:Ash1l	UTSW	3	88981900	missense	possibly damaging	0.63
R9450:Ash1l	UTSW	3	89007832	missense	possibly damaging	0.86
R9542:Ash1l	UTSW	3	89043259	missense	probably damaging	1.00
R9558:Ash1l	UTSW	3	88982214	missense	probably benign	0.02
R9572:Ash1l	UTSW	3	89052881	missense	probably damaging	1.00
R9688:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R9736:Ash1l	UTSW	3	88984426	missense	probably damaging	1.00
R9765:Ash1l	UTSW	3	89023193	missense	probably damaging	1.00
R9789:Ash1l	UTSW	3	88966066	missense	probably benign
X0017:Ash1l	UTSW	3	88984585	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	89070556	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88983204	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88982709	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	89043217	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTAGTTAGAGCTCCGCTG -3'
(R):5'- GGAACACCTACTTGCTGACTTTTC -3'

Sequencing Primer
(F):5'- CTCCATGGGCAACTGTATGAACATG -3'
(R):5'- TTCAGAAAGAAGTGGGATATTACTGC -3'

Posted On

2022-01-20