Incidental Mutation 'R9164:Gtf3c4'
ID 695889
Institutional Source Beutler Lab
Gene Symbol Gtf3c4
Ensembl Gene ENSMUSG00000035666
Gene Name general transcription factor IIIC, polypeptide 4
Synonyms KAT12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28822299-28840360 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28834649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 357 (V357A)
Ref Sequence ENSEMBL: ENSMUSP00000042265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037117] [ENSMUST00000171404]
AlphaFold Q8BMQ2
Predicted Effect probably benign
Transcript: ENSMUST00000037117
AA Change: V357A

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042265
Gene: ENSMUSG00000035666
AA Change: V357A

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:TFIIIC_delta 59 250 1.1e-45 PFAM
low complexity region 609 621 N/A INTRINSIC
Pfam:zf-TFIIIC 728 816 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171404
AA Change: V216A

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132171
Gene: ENSMUSG00000035666
AA Change: V216A

DomainStartEndE-ValueType
Pfam:TFIIIC_delta 7 109 3.1e-17 PFAM
low complexity region 468 480 N/A INTRINSIC
Pfam:zf-TFIIIC 587 676 4.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Gtf3c4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Gtf3c4 APN 2 28833572 missense probably benign
IGL01419:Gtf3c4 APN 2 28835069 missense probably damaging 1.00
IGL01574:Gtf3c4 APN 2 28834436 missense possibly damaging 0.50
IGL01778:Gtf3c4 APN 2 28835088 missense probably damaging 1.00
IGL01802:Gtf3c4 APN 2 28834080 missense probably damaging 1.00
IGL02560:Gtf3c4 APN 2 28834267 nonsense probably null
R0190:Gtf3c4 UTSW 2 28840128 missense probably benign 0.19
R0245:Gtf3c4 UTSW 2 28834964 missense possibly damaging 0.71
R0440:Gtf3c4 UTSW 2 28840169 splice site probably null
R0882:Gtf3c4 UTSW 2 28834770 missense probably damaging 1.00
R1757:Gtf3c4 UTSW 2 28830636 splice site probably benign
R1809:Gtf3c4 UTSW 2 28833976 nonsense probably null
R1893:Gtf3c4 UTSW 2 28834362 missense possibly damaging 0.92
R1903:Gtf3c4 UTSW 2 28839956 missense probably benign 0.19
R2020:Gtf3c4 UTSW 2 28833894 missense possibly damaging 0.81
R2867:Gtf3c4 UTSW 2 28839904 utr 5 prime probably benign
R3076:Gtf3c4 UTSW 2 28835153 missense possibly damaging 0.56
R4113:Gtf3c4 UTSW 2 28827555 missense probably damaging 1.00
R4404:Gtf3c4 UTSW 2 28826749 missense probably damaging 1.00
R5751:Gtf3c4 UTSW 2 28827499 missense probably damaging 1.00
R5997:Gtf3c4 UTSW 2 28833711 missense possibly damaging 0.62
R8162:Gtf3c4 UTSW 2 28834581 nonsense probably null
R9170:Gtf3c4 UTSW 2 28840202 missense possibly damaging 0.86
R9232:Gtf3c4 UTSW 2 28834836 missense probably damaging 1.00
R9308:Gtf3c4 UTSW 2 28834970 missense probably damaging 1.00
R9415:Gtf3c4 UTSW 2 28833954 missense possibly damaging 0.95
Z1177:Gtf3c4 UTSW 2 28835073 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACGTGGGAATTGTGAACATTCAG -3'
(R):5'- TATAGCTGTGTGGCAGTTCC -3'

Sequencing Primer
(F):5'- ATTCAGACCTGCCTTGGAGATCAG -3'
(R):5'- GGAAGGAGTCCATCTCTTCATGC -3'
Posted On 2022-02-07