Incidental Mutation 'R9164:Olfr1206'
ID 695891
Institutional Source Beutler Lab
Gene Symbol Olfr1206
Ensembl Gene ENSMUSG00000062757
Gene Name olfactory receptor 1206
Synonyms Olfr1207, GA_x6K02T2Q125-50338497-50339264, MOR230-3, GA_x6K02T2Q125-50339974-50340609
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88863231-88867753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88865451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 282 (P282L)
Ref Sequence ENSEMBL: ENSMUSP00000149929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077302] [ENSMUST00000216950]
AlphaFold A2ATJ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000077302
AA Change: P282L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076532
Gene: ENSMUSG00000062757
AA Change: P282L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216950
AA Change: P282L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Olfr1206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Olfr1206 APN 2 88865520 missense probably benign 0.00
IGL01415:Olfr1206 APN 2 88865520 missense probably benign 0.00
IGL01783:Olfr1206 APN 2 88864842 missense probably damaging 0.98
PIT4812001:Olfr1206 UTSW 2 88864970 missense probably benign 0.27
R0437:Olfr1206 UTSW 2 88864885 missense probably benign 0.01
R0561:Olfr1206 UTSW 2 88864680 missense possibly damaging 0.68
R0669:Olfr1206 UTSW 2 88864928 missense probably benign
R0835:Olfr1206 UTSW 2 88865001 missense probably benign
R0987:Olfr1206 UTSW 2 88865183 missense probably benign 0.00
R1271:Olfr1206 UTSW 2 88865131 nonsense probably null
R1386:Olfr1206 UTSW 2 88865353 missense probably benign 0.14
R1618:Olfr1206 UTSW 2 88865527 splice site probably null
R1935:Olfr1206 UTSW 2 88865180 missense probably benign
R2098:Olfr1206 UTSW 2 88864871 missense probably benign 0.43
R2112:Olfr1206 UTSW 2 88865201 missense possibly damaging 0.67
R2157:Olfr1206 UTSW 2 88864869 missense probably benign
R2912:Olfr1206 UTSW 2 88865114 missense probably benign 0.17
R2913:Olfr1206 UTSW 2 88865114 missense probably benign 0.17
R4583:Olfr1206 UTSW 2 88865494 missense probably benign 0.07
R4631:Olfr1206 UTSW 2 88864830 missense probably benign 0.00
R7707:Olfr1206 UTSW 2 88864809 missense possibly damaging 0.78
R8559:Olfr1206 UTSW 2 88865183 missense probably benign 0.00
R9163:Olfr1206 UTSW 2 88865451 missense possibly damaging 0.63
R9468:Olfr1206 UTSW 2 88865451 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CGAAACCACAGTGCTGAAGG -3'
(R):5'- GACAGTATTGGACTATCTGCCAG -3'

Sequencing Primer
(F):5'- ACGGCCACCAACTACTTT -3'
(R):5'- GGACTATCTGCCAGATTATATTTAAT -3'
Posted On 2022-02-07