Incidental Mutation 'R9164:Phtf2'
ID 695910
Institutional Source Beutler Lab
Gene Symbol Phtf2
Ensembl Gene ENSMUSG00000039987
Gene Name putative homeodomain transcription factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 20758663-20882124 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 20803192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 164 (R164*)
Ref Sequence ENSEMBL: ENSMUSP00000114087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118174] [ENSMUST00000156044]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000118174
AA Change: R164*
SMART Domains Protein: ENSMUSP00000114087
Gene: ENSMUSG00000039987
AA Change: R164*

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 154 1.3e-76 PFAM
low complexity region 340 359 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
transmembrane domain 511 533 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
transmembrane domain 628 647 N/A INTRINSIC
transmembrane domain 715 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124431
Predicted Effect probably benign
Transcript: ENSMUST00000156044
SMART Domains Protein: ENSMUSP00000120222
Gene: ENSMUSG00000039987

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 46 3.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Phtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Phtf2 APN 5 20782267 unclassified probably benign
IGL01789:Phtf2 APN 5 20794374 missense probably benign 0.00
IGL01816:Phtf2 APN 5 20803276 missense probably damaging 1.00
IGL02266:Phtf2 APN 5 20805799 missense probably damaging 1.00
IGL02295:Phtf2 APN 5 20807430 missense probably damaging 1.00
IGL03086:Phtf2 APN 5 20764275 missense probably damaging 0.99
IGL03179:Phtf2 APN 5 20782399 missense probably damaging 1.00
IGL03192:Phtf2 APN 5 20761719 missense probably damaging 0.99
IGL03256:Phtf2 APN 5 20803252 missense probably damaging 0.98
PIT4480001:Phtf2 UTSW 5 20813244 missense probably damaging 1.00
PIT4802001:Phtf2 UTSW 5 20801906 missense probably damaging 0.96
R0589:Phtf2 UTSW 5 20813251 nonsense probably null
R1732:Phtf2 UTSW 5 20789627 critical splice donor site probably null
R3151:Phtf2 UTSW 5 20765804 missense probably damaging 1.00
R3791:Phtf2 UTSW 5 20782298 missense probably damaging 1.00
R3843:Phtf2 UTSW 5 20774022 missense probably damaging 1.00
R4080:Phtf2 UTSW 5 20813296 missense probably damaging 1.00
R4569:Phtf2 UTSW 5 20789595 intron probably benign
R4627:Phtf2 UTSW 5 20773740 missense probably damaging 1.00
R4901:Phtf2 UTSW 5 20805724 missense possibly damaging 0.73
R5131:Phtf2 UTSW 5 20774052 missense probably damaging 1.00
R5276:Phtf2 UTSW 5 20772197 missense probably benign 0.19
R5871:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R5941:Phtf2 UTSW 5 20774073 missense probably damaging 0.98
R5964:Phtf2 UTSW 5 20775934 missense probably damaging 1.00
R6318:Phtf2 UTSW 5 20801941 missense probably damaging 1.00
R6621:Phtf2 UTSW 5 20812956 intron probably benign
R6684:Phtf2 UTSW 5 20812939 critical splice donor site probably benign
R7003:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R7253:Phtf2 UTSW 5 20765858 missense possibly damaging 0.73
R7566:Phtf2 UTSW 5 20765801 missense probably damaging 1.00
R7654:Phtf2 UTSW 5 20782461 missense probably damaging 0.99
R8117:Phtf2 UTSW 5 20802040 missense probably benign 0.30
R8514:Phtf2 UTSW 5 20802032 missense possibly damaging 0.49
R8921:Phtf2 UTSW 5 20803277 missense probably benign 0.00
R8975:Phtf2 UTSW 5 20764251 missense probably damaging 1.00
R9028:Phtf2 UTSW 5 20794375 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGGTTTATCGGAAAGAGCTAC -3'
(R):5'- CTCCATTTGTAGTTGCTGCAATAG -3'

Sequencing Primer
(F):5'- ATGGACCTAAGTTCAGTTCCCAG -3'
(R):5'- GCTGCAATAGTATTATTCTGTTCCG -3'
Posted On 2022-02-07