Incidental Mutation 'R9164:Cep120'
ID 695951
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 53681724-53744547 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53719246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 520 (M520K)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect probably benign
Transcript: ENSMUST00000049811
AA Change: M520K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: M520K

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53685961 missense probably benign 0.24
IGL01774:Cep120 APN 18 53706830 missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53714767 missense probably benign 0.01
IGL01906:Cep120 APN 18 53714912 missense probably benign
IGL01941:Cep120 APN 18 53723148 missense probably benign 0.00
IGL02952:Cep120 APN 18 53683228 utr 3 prime probably benign
IGL03248:Cep120 APN 18 53735772 missense probably benign 0.04
IGL03379:Cep120 APN 18 53709136 missense probably benign
R0019:Cep120 UTSW 18 53709047 splice site probably benign
R0039:Cep120 UTSW 18 53685961 missense probably benign 0.24
R0763:Cep120 UTSW 18 53721737 missense probably benign 0.00
R1015:Cep120 UTSW 18 53703121 critical splice donor site probably null
R1340:Cep120 UTSW 18 53724391 missense probably damaging 1.00
R1507:Cep120 UTSW 18 53697657 missense probably damaging 0.99
R1649:Cep120 UTSW 18 53724576 missense probably damaging 1.00
R1727:Cep120 UTSW 18 53727729 missense probably benign 0.01
R1739:Cep120 UTSW 18 53719214 critical splice donor site probably null
R1873:Cep120 UTSW 18 53738488 missense probably damaging 0.98
R1913:Cep120 UTSW 18 53723286 missense probably benign 0.26
R1968:Cep120 UTSW 18 53723241 missense probably benign 0.42
R1995:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2042:Cep120 UTSW 18 53735742 missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53719312 missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2215:Cep120 UTSW 18 53727635 missense probably damaging 1.00
R2697:Cep120 UTSW 18 53740125 missense probably benign 0.00
R3813:Cep120 UTSW 18 53740212 splice site probably benign
R4012:Cep120 UTSW 18 53738582 missense probably damaging 0.99
R4368:Cep120 UTSW 18 53685885 splice site probably null
R4615:Cep120 UTSW 18 53714841 missense probably damaging 1.00
R4772:Cep120 UTSW 18 53718489 missense probably damaging 1.00
R4780:Cep120 UTSW 18 53724536 missense probably benign 0.12
R5195:Cep120 UTSW 18 53721698 missense probably damaging 1.00
R5991:Cep120 UTSW 18 53721798 missense probably benign
R6156:Cep120 UTSW 18 53703223 missense probably benign 0.00
R6188:Cep120 UTSW 18 53724457 missense probably benign 0.03
R6688:Cep120 UTSW 18 53724536 missense probably benign 0.12
R6961:Cep120 UTSW 18 53703205 nonsense probably null
R7143:Cep120 UTSW 18 53683385 missense probably benign 0.00
R7282:Cep120 UTSW 18 53740089 missense probably damaging 1.00
R7813:Cep120 UTSW 18 53738506 missense probably damaging 1.00
R7818:Cep120 UTSW 18 53723103 missense probably benign
R8677:Cep120 UTSW 18 53738561 missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53723127 missense possibly damaging 0.88
R9225:Cep120 UTSW 18 53706824 missense probably benign 0.00
R9300:Cep120 UTSW 18 53719297 missense probably damaging 0.99
R9312:Cep120 UTSW 18 53727641 missense probably benign 0.08
R9377:Cep120 UTSW 18 53718520 missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53706912 nonsense probably null
R9499:Cep120 UTSW 18 53685961 missense possibly damaging 0.94
R9551:Cep120 UTSW 18 53685961 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGCCTTAAGATGTTTCTAACGCC -3'
(R):5'- TAAAACCATCTGGCCTTCCGTG -3'

Sequencing Primer
(F):5'- TTTACAGAGACCATGTGAAGCCCTG -3'
(R):5'- GGCCTTCCGTGTTGGCTC -3'
Posted On 2022-02-07