Incidental Mutation 'R9262:Pole'
ID 702307
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9262 (G1)
Quality Score 161.009
Status Not validated
Chromosome 5
Chromosomal Location 110286306-110337474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110325557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1739 (L1739H)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
AlphaFold Q9WVF7
Predicted Effect probably damaging
Transcript: ENSMUST00000007296
AA Change: L1739H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: L1739H

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,588 M473V probably benign Het
4933409G03Rik A T 2: 68,613,031 H192L unknown Het
Abca4 T A 3: 122,170,990 C2149S probably damaging Het
Abl2 G A 1: 156,642,250 G1028D possibly damaging Het
Adgre1 A G 17: 57,447,941 T680A probably damaging Het
Amn G A 12: 111,271,151 W10* probably null Het
Ankhd1 G T 18: 36,632,746 V140F Het
Asnsd1 A T 1: 53,344,775 N613K probably benign Het
Bbs2 A T 8: 94,080,915 I417N probably damaging Het
Cad T A 5: 31,067,665 W971R probably null Het
Cand2 A T 6: 115,782,769 I134F probably benign Het
Ccdc154 C A 17: 25,170,186 H453N probably damaging Het
Ccdc7a T A 8: 128,759,796 H1601L possibly damaging Het
Ccdc9 A C 7: 16,278,475 S261A probably benign Het
Cdkl3 T A 11: 52,025,875 S277T probably benign Het
Cipc T A 12: 86,952,723 Y8* probably null Het
Cramp1l A G 17: 25,013,946 S27P probably damaging Het
Csf1r A T 18: 61,110,334 M141L probably benign Het
Csf2rb2 G T 15: 78,284,335 F873L probably damaging Het
Dchs1 G A 7: 105,755,626 R2570W probably damaging Het
Dmxl1 A T 18: 49,843,852 N94Y probably benign Het
Dnajc10 A G 2: 80,346,621 K640R probably benign Het
Epha8 A C 4: 136,931,684 H886Q probably benign Het
Fcgbp G C 7: 28,120,527 D2560H probably damaging Het
Fry T G 5: 150,381,644 F605V probably damaging Het
Fsip2 A G 2: 82,977,318 N1327S probably benign Het
Gm12117 T C 11: 33,276,001 T112A probably benign Het
Gm3604 A T 13: 62,369,883 N220K probably damaging Het
Gm572 T C 4: 148,651,195 V27A probably benign Het
Gm6614 G T 6: 141,980,868 F597L probably damaging Het
Gm8251 A G 1: 44,057,109 S1610P possibly damaging Het
Gm853 A G 4: 130,220,360 V88A possibly damaging Het
Gpr39 A G 1: 125,872,787 K425R probably benign Het
Heatr3 A G 8: 88,156,469 D349G probably benign Het
Hip1 A G 5: 135,449,687 S248P probably damaging Het
Itga11 A G 9: 62,752,396 probably benign Het
Itga3 C T 11: 95,065,799 V210I probably benign Het
Jmjd1c T C 10: 67,248,014 I2173T probably benign Het
Klf13 G A 7: 63,924,708 Q21* probably null Het
Kmt2a A T 9: 44,819,925 S3032T probably benign Het
Krt34 T C 11: 100,040,025 R184G probably benign Het
Krtap16-1 T C 11: 99,986,168 T137A probably benign Het
Mgam T C 6: 40,746,488 probably null Het
Mog T C 17: 37,014,756 T196A possibly damaging Het
Ms4a6d T C 19: 11,601,852 Y87C possibly damaging Het
Ndrg4 C T 8: 95,709,184 probably benign Het
Nsd1 T A 13: 55,247,058 M927K possibly damaging Het
Olfr1246 G T 2: 89,591,091 T8K probably damaging Het
Olfr323 T A 11: 58,625,456 M197L probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcdhac2 A G 18: 37,146,042 R692G possibly damaging Het
Pcsk4 T A 10: 80,325,030 S321C probably damaging Het
Pi4ka A G 16: 17,302,995 F1292L Het
Pigv G T 4: 133,669,799 P6Q possibly damaging Het
Pkhd1 A C 1: 20,548,127 S927A probably benign Het
Pnpla3 A T 15: 84,171,162 I90F probably benign Het
Rbm12 A T 2: 156,097,397 N318K possibly damaging Het
Rpl18a A T 8: 70,895,535 L168Q probably benign Het
Ryr2 T C 13: 11,750,968 N1294S probably damaging Het
Sema5b T C 16: 35,632,853 L98P possibly damaging Het
Smg7 A G 1: 152,845,511 V650A probably damaging Het
Strada C T 11: 106,184,618 R13Q probably damaging Het
Sun1 T C 5: 139,215,163 S37P unknown Het
Syce1l T C 8: 113,654,106 probably null Het
Tdg T A 10: 82,644,673 F263L probably damaging Het
Tead3 G T 17: 28,341,521 S36R probably benign Het
Timm44 A G 8: 4,260,621 L377P probably damaging Het
Tk1 C T 11: 117,825,755 V9M probably benign Het
Trim36 A G 18: 46,167,439 Y722H probably benign Het
Ttn A T 2: 76,809,888 M13792K possibly damaging Het
Unc80 A G 1: 66,555,252 probably benign Het
Usp46 G T 5: 74,029,304 A133E probably benign Het
Wnk2 T A 13: 49,067,954 R1240S probably benign Het
Zfp821 G A 8: 109,724,350 R325Q probably damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7960:Pole UTSW 5 110289861 missense possibly damaging 0.81
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8835:Pole UTSW 5 110306909 missense probably damaging 1.00
R8863:Pole UTSW 5 110289367 missense possibly damaging 0.94
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
R8968:Pole UTSW 5 110312083 missense possibly damaging 0.78
R8992:Pole UTSW 5 110323622 missense possibly damaging 0.88
R9018:Pole UTSW 5 110289809 missense probably benign 0.37
R9177:Pole UTSW 5 110332422 missense probably benign 0.04
R9250:Pole UTSW 5 110299821 missense possibly damaging 0.88
R9262:Pole UTSW 5 110325556 missense probably damaging 0.99
R9367:Pole UTSW 5 110297089 missense probably damaging 0.99
R9383:Pole UTSW 5 110291026 missense possibly damaging 0.61
R9626:Pole UTSW 5 110312093 missense possibly damaging 0.68
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCTTCTGCTCAACCATGTG -3'
(R):5'- TGACGGCAGATACCTGAAGG -3'

Sequencing Primer
(F):5'- CTTCTGCTCAACCATGTGGAAGAAG -3'
(R):5'- CCTGAAGGTACTAGAGCAGAGG -3'
Posted On 2022-03-25