Incidental Mutation 'R9336:Erbb3'
ID 707173
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Name erb-b2 receptor tyrosine kinase 3
Synonyms Erbb-3, Erbb3r, HER3
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 128567523-128589652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128585060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
AlphaFold Q61526
Predicted Effect probably benign
Transcript: ENSMUST00000082059
AA Change: T125A

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: T125A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dsg3 C A 18: 20,524,685 Q271K probably benign Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Kmt2d A C 15: 98,845,816 L3821R unknown Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pbx3 T A 2: 34,371,820 H34L probably benign Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pik3c2g G T 6: 139,875,435 Q687H Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tas2r126 T C 6: 42,434,943 S137P probably benign Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Vmn2r120 T A 17: 57,525,201 D196V possibly damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128583200 missense probably damaging 0.99
R8843:Erbb3 UTSW 10 128578456 missense possibly damaging 0.82
R8988:Erbb3 UTSW 10 128570161 missense probably damaging 1.00
R9530:Erbb3 UTSW 10 128574422 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCCATCACATAAGGTTCCTCC -3'
(R):5'- GGCCTAAGACCCTGTTGTTC -3'

Sequencing Primer
(F):5'- GGACCCTCTACTGCTTAAAGAGTAG -3'
(R):5'- AAGACCCTGTTGTTCTTTTCACTG -3'
Posted On 2022-04-18