Incidental Mutation 'R1036:Kcnk10'
ID93808
Institutional Source Beutler Lab
Gene Symbol Kcnk10
Ensembl Gene ENSMUSG00000033854
Gene Namepotassium channel, subfamily K, member 10
Synonyms
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98429437-98578310 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 98496186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110113] [ENSMUST00000221240] [ENSMUST00000221305]
Predicted Effect probably benign
Transcript: ENSMUST00000110113
SMART Domains Protein: ENSMUSP00000105740
Gene: ENSMUSG00000033854

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ion_trans 55 207 9.3e-8 PFAM
Pfam:Ion_trans_2 126 204 3.3e-20 PFAM
Pfam:Ion_trans_2 223 321 8.5e-21 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221240
Predicted Effect probably benign
Transcript: ENSMUST00000221305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221906
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal glucose hyperpolarization of hypothalamic neurons in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Kcnk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Kcnk10 APN 12 98518533 missense probably damaging 0.99
IGL01409:Kcnk10 APN 12 98490063 missense probably damaging 1.00
IGL02149:Kcnk10 APN 12 98518840 splice site probably benign
R0467:Kcnk10 UTSW 12 98489945 missense probably benign 0.43
R0558:Kcnk10 UTSW 12 98436301 missense possibly damaging 0.89
R0665:Kcnk10 UTSW 12 98440685 missense probably benign 0.00
R1033:Kcnk10 UTSW 12 98518670 missense possibly damaging 0.93
R1398:Kcnk10 UTSW 12 98436226 missense probably damaging 0.99
R1482:Kcnk10 UTSW 12 98489948 missense probably damaging 0.99
R1675:Kcnk10 UTSW 12 98496288 missense probably benign 0.31
R2858:Kcnk10 UTSW 12 98435289 missense possibly damaging 0.64
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R3736:Kcnk10 UTSW 12 98489912 missense probably benign 0.31
R3845:Kcnk10 UTSW 12 98440744 missense probably benign 0.11
R4077:Kcnk10 UTSW 12 98434946 missense probably benign 0.03
R4541:Kcnk10 UTSW 12 98436277 missense probably damaging 1.00
R4605:Kcnk10 UTSW 12 98489960 missense probably damaging 1.00
R4841:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4842:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4886:Kcnk10 UTSW 12 98435159 missense possibly damaging 0.89
R4968:Kcnk10 UTSW 12 98434902 missense probably benign 0.01
R4977:Kcnk10 UTSW 12 98440687 missense probably benign 0.07
R5108:Kcnk10 UTSW 12 98435301 missense probably benign 0.39
R5166:Kcnk10 UTSW 12 98434995 missense probably damaging 0.98
R5936:Kcnk10 UTSW 12 98489932 missense probably benign 0.12
R6193:Kcnk10 UTSW 12 98440772 missense probably benign 0.07
R7107:Kcnk10 UTSW 12 98518743 nonsense probably null
R7611:Kcnk10 UTSW 12 98518640 missense probably damaging 1.00
R7687:Kcnk10 UTSW 12 98435096 missense probably damaging 0.97
X0067:Kcnk10 UTSW 12 98518824 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTCGAGAAACAACCCCTGAAATGG -3'
(R):5'- TGCAGGTTCCTGAGCAGTATAGTGA -3'

Sequencing Primer
(F):5'- CCGGTTTGATATTTAAAGCCACAC -3'
(R):5'- CCTGAGCAGTATAGTGATTTATTGG -3'
Posted On2014-01-05