Incidental Mutation 'R1036:Gbe1'
ID93824
Institutional Source Beutler Lab
Gene Symbol Gbe1
Ensembl Gene ENSMUSG00000022707
Gene Nameglucan (1,4-alpha-), branching enzyme 1
Synonyms2310045H19Rik, D16Ertd536e, 2810426P10Rik
MMRRC Submission 039135-MU
Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location70313949-70569716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70528887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 604 (V604E)
Ref Sequence ENSEMBL: ENSMUSP00000127642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464] [ENSMUST00000171132]
Predicted Effect probably damaging
Transcript: ENSMUST00000023393
AA Change: V604E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707
AA Change: V604E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163832
AA Change: V604E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707
AA Change: V604E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 6e-19 PFAM
Pfam:Alpha-amylase 220 337 5.9e-14 PFAM
Pfam:Alpha-amylase_C 603 698 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164300
Predicted Effect probably damaging
Transcript: ENSMUST00000170464
AA Change: V604E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707
AA Change: V604E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171132
AA Change: V604E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127642
Gene: ENSMUSG00000022707
AA Change: V604E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 1.8e-17 PFAM
Pfam:Alpha-amylase 218 338 2.7e-18 PFAM
Pfam:Alpha-amylase_C 603 650 4.1e-12 PFAM
Meta Mutation Damage Score 0.7728 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Gbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Gbe1 APN 16 70478369 missense probably damaging 1.00
IGL01783:Gbe1 APN 16 70401855 critical splice donor site probably null
IGL02437:Gbe1 APN 16 70434658 splice site probably benign
IGL02635:Gbe1 APN 16 70569014 missense probably damaging 1.00
IGL02836:Gbe1 APN 16 70561095 missense possibly damaging 0.90
IGL03331:Gbe1 APN 16 70433578 missense probably damaging 1.00
IGL03138:Gbe1 UTSW 16 70529063 utr 3 prime probably benign
PIT4515001:Gbe1 UTSW 16 70441116 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0131:Gbe1 UTSW 16 70360852 splice site probably benign
R0178:Gbe1 UTSW 16 70478386 missense probably damaging 1.00
R0374:Gbe1 UTSW 16 70483914 missense probably benign 0.09
R1162:Gbe1 UTSW 16 70381850 intron probably benign
R1759:Gbe1 UTSW 16 70488041 missense probably benign 0.11
R1780:Gbe1 UTSW 16 70495324 nonsense probably null
R1998:Gbe1 UTSW 16 70569041 missense probably damaging 1.00
R2001:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2002:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2269:Gbe1 UTSW 16 70436952 missense probably damaging 1.00
R2353:Gbe1 UTSW 16 70437021 splice site probably null
R2434:Gbe1 UTSW 16 70441212 missense probably damaging 1.00
R4114:Gbe1 UTSW 16 70483827 missense possibly damaging 0.64
R4528:Gbe1 UTSW 16 70478337 missense probably benign
R4736:Gbe1 UTSW 16 70495253 missense probably damaging 1.00
R4859:Gbe1 UTSW 16 70478401 missense probably damaging 1.00
R5884:Gbe1 UTSW 16 70528875 splice site probably null
R6222:Gbe1 UTSW 16 70529012 critical splice donor site probably null
R6527:Gbe1 UTSW 16 70433672 critical splice donor site probably null
R6770:Gbe1 UTSW 16 70314265 missense possibly damaging 0.86
R6770:Gbe1 UTSW 16 70401838 missense probably damaging 1.00
R6941:Gbe1 UTSW 16 70433556 small deletion probably benign
R7193:Gbe1 UTSW 16 70495370 missense probably damaging 1.00
R7232:Gbe1 UTSW 16 70436940 missense possibly damaging 0.91
R7343:Gbe1 UTSW 16 70361015 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACCGTGGGCAGAGTTATGTGAAAAC -3'
(R):5'- ATAGGCACATGCACTGGCAGAG -3'

Sequencing Primer
(F):5'- CAACACTGACTGATCCTCTGG -3'
(R):5'- CTGGCAGAGAAAAGGATATTTCCC -3'
Posted On2014-01-05