Incidental Mutation 'R0990:Arhgap32'
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 039110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0990 (G1)
Quality Score183
Status Not validated
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32255381 bp
Amino Acid Change Aspartic acid to Glycine at position 438 (D438G)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]
Predicted Effect probably damaging
Transcript: ENSMUST00000168954
AA Change: D438G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: D438G

RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174641
AA Change: D787G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: D787G

Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182802
AA Change: D438G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: D438G

RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,325,452 V916A possibly damaging Het
Ank2 T C 3: 126,934,666 I759M possibly damaging Het
Arhgef12 T C 9: 42,972,381 Y1285C probably benign Het
Cfap65 A G 1: 74,921,519 V764A possibly damaging Het
Cog8 T A 8: 107,052,487 probably null Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo24 T C 5: 137,618,439 N394S probably damaging Het
Gm9938 A G 19: 23,724,592 probably benign Het
Iars2 A G 1: 185,318,627 F422L probably damaging Het
March3 A T 18: 56,807,798 C87S probably damaging Het
Mettl2 T A 11: 105,137,744 Y307* probably null Het
Mlh3 T C 12: 85,267,765 D549G probably benign Het
Muc4 A G 16: 32,752,722 T867A probably benign Het
Nup210l A T 3: 90,211,925 T1852S probably benign Het
Olfr1110 T A 2: 87,135,742 H193L possibly damaging Het
Pdk4 A T 6: 5,485,577 S371T probably benign Het
Pkm A G 9: 59,678,096 T454A probably damaging Het
Satb2 G A 1: 56,850,184 S340F probably damaging Het
Scel G A 14: 103,581,832 V354I possibly damaging Het
Setdb1 T C 3: 95,340,265 T440A probably benign Het
Sgk1 T C 10: 21,997,086 F230S probably damaging Het
Slc22a23 A T 13: 34,195,467 I439N probably damaging Het
Slc9a5 G A 8: 105,359,446 R615Q probably damaging Het
Smad1 T A 8: 79,343,788 I374F probably damaging Het
Tgm4 A G 9: 123,046,511 E143G probably benign Het
Vmn2r53 A G 7: 12,581,502 S797P probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32257028 missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32181900 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-05