Incidental Mutation 'R0990:Arhgap32'
ID 97629
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene Name Rho GTPase activating protein 32
Synonyms p200RhoGAP, Grit, PX-RICS, GC-GAP, 3426406O18Rik
MMRRC Submission 039110-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0990 (G1)
Quality Score 183
Status Not validated
Chromosome 9
Chromosomal Location 32027432-32179742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32166677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 438 (D438G)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]
AlphaFold Q811P8
Predicted Effect probably damaging
Transcript: ENSMUST00000168954
AA Change: D438G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: D438G

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174641
AA Change: D787G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: D787G

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182802
AA Change: D438G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: D438G

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 89,052,080 (GRCm39) V916A possibly damaging Het
Ank2 T C 3: 126,728,315 (GRCm39) I759M possibly damaging Het
Arhgef12 T C 9: 42,883,677 (GRCm39) Y1285C probably benign Het
Cfap65 A G 1: 74,960,678 (GRCm39) V764A possibly damaging Het
Cog8 T A 8: 107,779,119 (GRCm39) probably null Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fam120a G T 13: 49,039,219 (GRCm39) A979E possibly damaging Het
Fbxo24 T C 5: 137,616,701 (GRCm39) N394S probably damaging Het
Gm9938 A G 19: 23,701,956 (GRCm39) probably benign Het
Iars2 A G 1: 185,050,824 (GRCm39) F422L probably damaging Het
Marchf3 A T 18: 56,940,870 (GRCm39) C87S probably damaging Het
Mettl2 T A 11: 105,028,570 (GRCm39) Y307* probably null Het
Mlh3 T C 12: 85,314,539 (GRCm39) D549G probably benign Het
Muc4 A G 16: 32,752,722 (GRCm38) T867A probably benign Het
Nup210l A T 3: 90,119,232 (GRCm39) T1852S probably benign Het
Or5aq1 T A 2: 86,966,086 (GRCm39) H193L possibly damaging Het
Pdk4 A T 6: 5,485,577 (GRCm39) S371T probably benign Het
Pkm A G 9: 59,585,379 (GRCm39) T454A probably damaging Het
Satb2 G A 1: 56,889,343 (GRCm39) S340F probably damaging Het
Scel G A 14: 103,819,268 (GRCm39) V354I possibly damaging Het
Setdb1 T C 3: 95,247,576 (GRCm39) T440A probably benign Het
Sgk1 T C 10: 21,872,985 (GRCm39) F230S probably damaging Het
Slc22a23 A T 13: 34,379,450 (GRCm39) I439N probably damaging Het
Slc9a5 G A 8: 106,086,078 (GRCm39) R615Q probably damaging Het
Smad1 T A 8: 80,070,417 (GRCm39) I374F probably damaging Het
Tgm4 A G 9: 122,875,576 (GRCm39) E143G probably benign Het
Vmn2r53 A G 7: 12,315,429 (GRCm39) S797P probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32,168,657 (GRCm39) missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32,168,260 (GRCm39) missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32,171,801 (GRCm39) missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32,158,486 (GRCm39) missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32,170,627 (GRCm39) missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32,166,944 (GRCm39) missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32,158,490 (GRCm39) missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32,157,302 (GRCm39) missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32,172,431 (GRCm39) missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32,170,430 (GRCm39) missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32,170,816 (GRCm39) missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32,172,152 (GRCm39) missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32,063,294 (GRCm39) missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32,171,056 (GRCm39) missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32,157,773 (GRCm39) missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32,156,551 (GRCm39) critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32,170,199 (GRCm39) missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32,101,364 (GRCm39) splice site probably benign
R0856:Arhgap32 UTSW 9 32,171,516 (GRCm39) missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32,166,608 (GRCm39) missense probably benign
R1455:Arhgap32 UTSW 9 32,171,381 (GRCm39) missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32,027,498 (GRCm39) missense probably benign
R1523:Arhgap32 UTSW 9 32,168,048 (GRCm39) missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32,171,096 (GRCm39) missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32,170,727 (GRCm39) missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32,027,436 (GRCm39) missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32,171,207 (GRCm39) missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32,027,436 (GRCm39) missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32,158,793 (GRCm39) missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32,158,793 (GRCm39) missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32,150,694 (GRCm39) missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32,063,315 (GRCm39) splice site probably null
R3793:Arhgap32 UTSW 9 32,166,669 (GRCm39) missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32,101,320 (GRCm39) missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32,158,362 (GRCm39) unclassified probably benign
R4177:Arhgap32 UTSW 9 32,158,510 (GRCm39) missense probably null 1.00
R4230:Arhgap32 UTSW 9 32,168,770 (GRCm39) missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32,171,185 (GRCm39) missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32,093,135 (GRCm39) splice site probably null
R4587:Arhgap32 UTSW 9 32,172,241 (GRCm39) missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32,170,775 (GRCm39) missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32,150,644 (GRCm39) missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32,081,441 (GRCm39) missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32,172,076 (GRCm39) missense probably damaging 1.00
R4784:Arhgap32 UTSW 9 32,040,949 (GRCm39) missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32,172,076 (GRCm39) missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32,040,949 (GRCm39) missense probably damaging 0.99
R4906:Arhgap32 UTSW 9 32,156,552 (GRCm39) critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32,168,095 (GRCm39) missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32,170,967 (GRCm39) missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32,063,306 (GRCm39) missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32,159,678 (GRCm39) missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32,158,502 (GRCm39) missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32,093,256 (GRCm39) missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32,167,084 (GRCm39) missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32,168,275 (GRCm39) missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32,171,407 (GRCm39) missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32,159,784 (GRCm39) missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32,063,983 (GRCm39) missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32,157,272 (GRCm39) missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32,063,232 (GRCm39) missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32,097,679 (GRCm39) missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32,119,481 (GRCm39) missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32,063,993 (GRCm39) missense
R7289:Arhgap32 UTSW 9 32,168,234 (GRCm39) missense probably benign 0.02
R7289:Arhgap32 UTSW 9 32,168,233 (GRCm39) missense possibly damaging 0.92
R7391:Arhgap32 UTSW 9 32,093,235 (GRCm39) missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32,157,220 (GRCm39) missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32,162,018 (GRCm39) missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32,168,263 (GRCm39) missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32,168,441 (GRCm39) missense probably benign
R7884:Arhgap32 UTSW 9 32,171,810 (GRCm39) missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32,168,324 (GRCm39) missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32,093,150 (GRCm39) missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32,158,426 (GRCm39) missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32,093,196 (GRCm39) missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32,168,198 (GRCm39) missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32,172,205 (GRCm39) missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32,167,233 (GRCm39) nonsense probably null
R8696:Arhgap32 UTSW 9 32,159,799 (GRCm39) missense possibly damaging 0.90
R8832:Arhgap32 UTSW 9 32,172,115 (GRCm39) missense possibly damaging 0.94
R9112:Arhgap32 UTSW 9 32,157,309 (GRCm39) missense probably damaging 0.99
R9170:Arhgap32 UTSW 9 32,162,039 (GRCm39) missense possibly damaging 0.47
R9279:Arhgap32 UTSW 9 32,168,655 (GRCm39) missense probably benign 0.01
R9431:Arhgap32 UTSW 9 32,170,463 (GRCm39) missense probably damaging 1.00
R9522:Arhgap32 UTSW 9 32,027,450 (GRCm39) missense probably benign
R9526:Arhgap32 UTSW 9 32,172,026 (GRCm39) missense probably benign 0.28
R9661:Arhgap32 UTSW 9 32,168,531 (GRCm39) missense probably benign 0.01
X0027:Arhgap32 UTSW 9 32,161,937 (GRCm39) critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32,172,365 (GRCm39) missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32,171,976 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGTTGTTCCGACCTAGAAGACCC -3'
(R):5'- GGCTTAGAAGACTTGTCGTCAGTGG -3'

Sequencing Primer
(F):5'- CCAGATCCAGCAGCGATG -3'
(R):5'- TCTCCTGGACTGGAGATACAG -3'
Posted On 2014-01-05