Mutagenetix > Incidental Mutations

Incidental Mutation 'R7584:Arhgap32'

586974

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7584 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32116136-32268446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32256967 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 749 (T749S)

Ref Sequence

ENSEMBL: ENSMUSP00000138145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]

Predicted Effect

probably benign
Transcript: ENSMUST00000168954
AA Change: T749S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: T749S

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174641
AA Change: T1098S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: T1098S

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182802
AA Change: T749S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: T749S

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,110,361	F69L	possibly damaging	Het
1700123L14Rik	A	C	6: 96,165,392	L224V	probably benign	Het
Abcc10	A	G	17: 46,315,378		probably null	Het
Actrt3	T	C	3: 30,598,207	K246R	probably benign	Het
Adam23	T	A	1: 63,545,462	V343D	probably damaging	Het
Ak2	T	C	4: 128,999,212	S55P	probably damaging	Het
Ank2	G	A	3: 126,946,128	Q2036*	probably null	Het
Ano10	A	G	9: 122,275,531	I40T	probably benign	Het
Aoc2	T	A	11: 101,326,179	C363S	possibly damaging	Het
Aplp2	A	T	9: 31,157,781	V584E	possibly damaging	Het
Atm	A	T	9: 53,513,127	F625I	probably damaging	Het
Atr	T	C	9: 95,942,713	L2387P	probably damaging	Het
Barhl1	C	T	2: 28,909,791	G274D	probably damaging	Het
Bcl2a1a	A	T	9: 88,957,292	D81V	probably damaging	Het
Ccdc63	T	G	5: 122,113,204	D381A	possibly damaging	Het
Col12a1	A	G	9: 79,703,296		probably null	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Cyp4b1	T	A	4: 115,628,687	D351V	probably damaging	Het
D130043K22Rik	A	G	13: 24,872,370	S562G	probably damaging	Het
D430042O09Rik	G	T	7: 125,870,666	V1436L	probably damaging	Het
Dgkb	T	A	12: 38,139,392		probably null	Het
Dmbt1	C	T	7: 131,088,751	Q905*	probably null	Het
Dnajc21	A	C	15: 10,462,295	Y81*	probably null	Het
Dnali1	T	C	4: 125,065,538	T21A	probably benign	Het
Dpp8	A	T	9: 65,078,782	L851F	probably damaging	Het
Dpt	T	C	1: 164,818,908	Y149H	probably benign	Het
Ep300	T	C	15: 81,628,426	V983A	unknown	Het
Faf1	C	T	4: 109,925,957	R549C	probably damaging	Het
Gcm1	A	G	9: 78,064,467	N230S	possibly damaging	Het
Gm10803	T	A	2: 93,564,168	I95N	probably damaging	Het
Hectd4	T	A	5: 121,318,735	I721N	possibly damaging	Het
Hsp90ab1	T	C	17: 45,570,271	H315R	probably damaging	Het
Igkv10-95	T	A	6: 68,680,756	S85R	possibly damaging	Het
Kcnq5	T	C	1: 21,402,321	T901A	probably benign	Het
Kremen1	C	T	11: 5,194,964	V471M	possibly damaging	Het
Lama2	C	A	10: 27,104,261	D1853Y	possibly damaging	Het
Lrif1	A	G	3: 106,731,901	T76A	probably benign	Het
Lrrtm2	T	A	18: 35,212,765	I495F	possibly damaging	Het
Ltbr	G	T	6: 125,307,241	Q413K	probably benign	Het
Myrfl	T	A	10: 116,828,997	Y376F	probably damaging	Het
Nup98	G	T	7: 102,176,389	N414K	probably benign	Het
Nynrin	A	G	14: 55,871,584	T1383A	probably damaging	Het
Olfr1106	A	T	2: 87,049,134	I34N	probably benign	Het
Olfr1211	G	A	2: 88,929,805	P170L	probably damaging	Het
Olfr784	T	A	10: 129,388,032	I133N	probably damaging	Het
Olfr845	C	A	9: 19,339,273	T271K	possibly damaging	Het
Olfr915	G	T	9: 38,646,895	P210T	possibly damaging	Het
Pcdhb5	T	A	18: 37,322,372	S602T	possibly damaging	Het
Sall3	A	G	18: 80,974,530	F61S	probably benign	Het
Scube1	G	T	15: 83,721,887	C61*	probably null	Het
Sec31b	T	C	19: 44,543,323	D49G	probably damaging	Het
Sec31b	T	C	19: 44,531,556		probably null	Het
Skiv2l	A	G	17: 34,841,675	I822T	possibly damaging	Het
Slc19a3	C	T	1: 83,022,748	V183M	possibly damaging	Het
Slc41a2	T	C	10: 83,316,789		probably benign	Het
Sphk2	C	A	7: 45,712,507	V169L	probably damaging	Het
Synpo	C	A	18: 60,596,277	R951L	probably damaging	Het
Tbc1d9b	G	A	11: 50,170,716	C1017Y	probably damaging	Het
Tmtc4	C	A	14: 122,978,151	V28F	probably benign	Het
Tprkb	A	G	6: 85,928,827	I165V	probably benign	Het
Ttc23l	T	A	15: 10,533,708	I250F	probably damaging	Het
Ubr3	G	A	2: 69,991,503	V1370I	probably damaging	Het
Ush2a	A	G	1: 188,728,109		probably null	Het
Usp9y	T	C	Y: 1,384,451	Y689C	probably damaging	Het
Vmn1r56	A	T	7: 5,195,896	Y241N	probably damaging	Het
Vmn2r6	T	C	3: 64,565,262	T13A	probably benign	Het
Vmn2r92	T	A	17: 18,166,766	N122K	probably benign	Het
Vps9d1	A	G	8: 123,250,717	F131S	probably damaging	Het
Vwa8	A	C	14: 78,982,234		probably null	Het
Wfdc16	A	T	2: 164,638,627		probably null	Het
Zbtb41	T	A	1: 139,424,057	Y303N	probably benign	Het
Zbtb5	T	C	4: 44,993,678	T569A	probably benign	Het
Zcchc11	T	C	4: 108,479,346	V89A	probably benign	Het
Zfp111	A	G	7: 24,198,600	S530P	possibly damaging	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32257361	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32256964	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32260505	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32247190	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32259331	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32255648	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32247194	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32246006	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32261135	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32259134	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32259520	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32260856	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32151998	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32259760	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32246477	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32245255	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32258903	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32190068	splice site	probably benign
R0856:Arhgap32	UTSW	9	32260220	missense	probably damaging	1.00
R0990:Arhgap32	UTSW	9	32255381	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32255312	missense	probably benign
R1455:Arhgap32	UTSW	9	32260085	missense	probably benign	0.08
R1515:Arhgap32	UTSW	9	32116202	missense	probably benign
R1523:Arhgap32	UTSW	9	32256752	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32259800	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32259431	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32259911	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32239398	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32152019	splice site	probably null
R3793:Arhgap32	UTSW	9	32255373	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32190024	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32247066	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32247214	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32257474	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32259889	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32181839	splice site	probably null
R4587:Arhgap32	UTSW	9	32260945	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32259479	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32239348	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32170145	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4784:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4785:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4906:Arhgap32	UTSW	9	32245256	critical splice donor site	probably null
R5046:Arhgap32	UTSW	9	32256799	missense	probably damaging	1.00
R5360:Arhgap32	UTSW	9	32259671	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32152010	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32248382	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32247206	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32181960	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32255788	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32256979	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32260111	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32248488	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32152687	missense	possibly damaging	0.86
R7009:Arhgap32	UTSW	9	32245976	missense	probably damaging	1.00
R7137:Arhgap32	UTSW	9	32151936	missense	probably benign	0.32
R7183:Arhgap32	UTSW	9	32186383	missense	probably benign	0.15
R7251:Arhgap32	UTSW	9	32208185	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32152697	missense
R7289:Arhgap32	UTSW	9	32256937	missense	possibly damaging	0.92
R7289:Arhgap32	UTSW	9	32256938	missense	probably benign	0.02
R7391:Arhgap32	UTSW	9	32181939	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32245924	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32250722	missense	probably benign	0.10
R7653:Arhgap32	UTSW	9	32257145	missense	probably benign
R7884:Arhgap32	UTSW	9	32260514	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32257028	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32181854	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32247130	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32181900	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32256902	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32260909	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32255937	nonsense	probably null
X0027:Arhgap32	UTSW	9	32250641	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32261069	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32260680	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AAAATGTCGCCCGAATGTTGG -3'
(R):5'- GGAGCTGAAGTGCTTCTAGC -3'

Sequencing Primer
(F):5'- CCGAATGTTGGCACTAGCGTTAG -3'
(R):5'- CCCCAGATATATGGTTTCGATGTAGC -3'

Posted On

2019-10-24