Incidental Mutation 'R7251:Arhgap32'
ID563931
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7251 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32208185 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 308 (V308A)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641] [ENSMUST00000182802]
Predicted Effect probably damaging
Transcript: ENSMUST00000174641
AA Change: V308A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: V308A

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182802
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Meta Mutation Damage Score 0.3262 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Adamts19 A T 18: 58,837,902 D186V probably damaging Het
Agrn T C 4: 156,174,606 D884G probably damaging Het
Akr1c6 T A 13: 4,447,020 C154S probably damaging Het
Apob T C 12: 8,007,037 Y1840H probably damaging Het
Arfgef1 T C 1: 10,198,975 E399G possibly damaging Het
Arg2 G A 12: 79,150,798 G197S probably damaging Het
Atcay A T 10: 81,210,532 C319* probably null Het
Bend4 C G 5: 67,427,533 R16P unknown Het
Braf A G 6: 39,677,570 probably null Het
Camsap1 T C 2: 25,938,886 E942G probably damaging Het
Cdpf1 C T 15: 85,809,293 G11D probably damaging Het
Cgn T C 3: 94,776,199 E382G possibly damaging Het
Cndp1 T A 18: 84,622,197 E294D probably benign Het
Cnn1 T A 9: 22,108,217 Y294N unknown Het
Cyp2ab1 A G 16: 20,315,896 F104S possibly damaging Het
Cyp2t4 G A 7: 27,157,719 V336M possibly damaging Het
D430041D05Rik T A 2: 104,221,166 D782V probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dgkb T C 12: 37,981,986 S16P possibly damaging Het
Dll4 T C 2: 119,332,292 C465R probably damaging Het
Dsp A G 13: 38,193,548 I1770V probably benign Het
Fbxw11 A G 11: 32,731,370 N250S probably benign Het
Fsip2 G A 2: 82,979,081 V1915M possibly damaging Het
Greb1l G A 18: 10,515,319 V704M probably damaging Het
Hgf T A 5: 16,593,944 N323K possibly damaging Het
Hhatl A T 9: 121,785,050 probably null Het
Hip1r T C 5: 123,994,750 S204P probably damaging Het
Igsf10 T A 3: 59,319,454 N2266I probably damaging Het
Krtap15 A G 16: 88,829,094 probably null Het
Lrp1 T C 10: 127,572,554 D1751G probably damaging Het
Madd A T 2: 91,162,176 D1050E probably benign Het
Man1c1 C T 4: 134,580,836 G323R probably damaging Het
Mgll A G 6: 88,823,375 E252G probably benign Het
Muc2 A G 7: 141,692,722 N145S possibly damaging Het
Ncoa2 C T 1: 13,148,375 S1410N probably benign Het
Nek10 A G 14: 14,853,965 T384A probably benign Het
Nexn T C 3: 152,247,195 E310G probably damaging Het
Nol10 T C 12: 17,402,107 L354P probably damaging Het
Npy4r T C 14: 34,146,915 R139G probably damaging Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1062 G A 2: 86,423,596 L27F probably benign Het
Olfr301 T C 7: 86,413,001 V213A probably benign Het
Olfr622 C T 7: 103,639,702 G146D probably damaging Het
Pdzd8 A T 19: 59,300,645 N774K possibly damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pot1a T C 6: 25,752,498 probably null Het
Ppip5k1 T A 2: 121,347,571 E283D probably benign Het
Ptpn2 A C 18: 67,675,792 I318R possibly damaging Het
Raph1 A G 1: 60,489,868 F745L unknown Het
Rgs19 C T 2: 181,689,748 V88I probably benign Het
Ripk4 A G 16: 97,743,249 S733P probably benign Het
Rprd1b T A 2: 158,028,979 W29R probably damaging Het
Rtkn A G 6: 83,135,962 N5S probably damaging Het
Sh3bp5l A T 11: 58,341,302 Q131L probably damaging Het
Slain2 T A 5: 72,974,548 F461I possibly damaging Het
Stk24 A T 14: 121,308,022 L108Q probably damaging Het
Syne3 TC T 12: 104,961,571 probably null Het
Tapbpl A T 6: 125,226,595 V374E probably damaging Het
Tax1bp1 A G 6: 52,721,356 I18V possibly damaging Het
Tecta T A 9: 42,387,752 I233F probably damaging Het
Tet3 A G 6: 83,404,056 S377P probably benign Het
Uty A G Y: 1,154,262 S721P probably benign Het
Wnk4 C A 11: 101,265,153 T412K possibly damaging Het
Zdhhc11 G T 13: 73,992,097 V336L probably benign Het
Zfp605 T A 5: 110,127,960 S315T probably damaging Het
Zfp746 A G 6: 48,064,877 L305P probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32257028 missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32181900 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGCTTCATATACTCATAGCAACAG -3'
(R):5'- TGTAACACGCTCTACACAAAGG -3'

Sequencing Primer
(F):5'- GCGGAGTACATTACTGGA -3'
(R):5'- CATGCGTTACATCAATAAATGCAAAG -3'
Posted On2019-06-26