Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Arhgap32'

544906

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32116136-32268446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32245976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 90 (I90F)

Ref Sequence

ENSEMBL: ENSMUSP00000138584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802] [ENSMUST00000183121]

AlphaFold

Q811P8

Predicted Effect

probably damaging
Transcript: ENSMUST00000168954
AA Change: I90F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: I90F

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174641
AA Change: I439F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: I439F

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182802
AA Change: I90F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: I90F

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183121
AA Change: I90F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138584
Gene: ENSMUSG00000041444
AA Change: I90F

Domain	Start	End	E-Value	Type
Pfam:RhoGAP	37	92	5.9e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32257361	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32256964	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32260505	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32247190	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32259331	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32255648	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32247194	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32246006	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32261135	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32259134	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32259520	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32260856	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32151998	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32259760	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32246477	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32245255	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32258903	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32190068	splice site	probably benign
R0856:Arhgap32	UTSW	9	32260220	missense	probably damaging	1.00
R0990:Arhgap32	UTSW	9	32255381	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32255312	missense	probably benign
R1455:Arhgap32	UTSW	9	32260085	missense	probably benign	0.08
R1515:Arhgap32	UTSW	9	32116202	missense	probably benign
R1523:Arhgap32	UTSW	9	32256752	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32259800	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32259431	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32259911	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32239398	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32152019	splice site	probably null
R3793:Arhgap32	UTSW	9	32255373	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32190024	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32247066	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32247214	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32257474	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32259889	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32181839	splice site	probably null
R4587:Arhgap32	UTSW	9	32260945	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32259479	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32239348	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32170145	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4784:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4785:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4906:Arhgap32	UTSW	9	32245256	critical splice donor site	probably null
R5046:Arhgap32	UTSW	9	32256799	missense	probably damaging	1.00
R5360:Arhgap32	UTSW	9	32259671	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32152010	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32248382	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32247206	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32181960	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32255788	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32256979	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32260111	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32248488	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32152687	missense	possibly damaging	0.86
R7137:Arhgap32	UTSW	9	32151936	missense	probably benign	0.32
R7183:Arhgap32	UTSW	9	32186383	missense	probably benign	0.15
R7251:Arhgap32	UTSW	9	32208185	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32152697	missense
R7289:Arhgap32	UTSW	9	32256937	missense	possibly damaging	0.92
R7289:Arhgap32	UTSW	9	32256938	missense	probably benign	0.02
R7391:Arhgap32	UTSW	9	32181939	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32245924	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32250722	missense	probably benign	0.10
R7584:Arhgap32	UTSW	9	32256967	missense	probably benign	0.16
R7653:Arhgap32	UTSW	9	32257145	missense	probably benign
R7884:Arhgap32	UTSW	9	32260514	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32257028	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32181854	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32247130	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32181900	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32256902	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32260909	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32255937	nonsense	probably null
R8696:Arhgap32	UTSW	9	32248503	missense	possibly damaging	0.90
R8832:Arhgap32	UTSW	9	32260819	missense	possibly damaging	0.94
R9112:Arhgap32	UTSW	9	32246013	missense	probably damaging	0.99
R9170:Arhgap32	UTSW	9	32250743	missense	possibly damaging	0.47
R9279:Arhgap32	UTSW	9	32257359	missense	probably benign	0.01
R9431:Arhgap32	UTSW	9	32259167	missense	probably damaging	1.00
R9522:Arhgap32	UTSW	9	32116154	missense	probably benign
R9526:Arhgap32	UTSW	9	32260730	missense	probably benign	0.28
R9661:Arhgap32	UTSW	9	32257235	missense	probably benign	0.01
X0027:Arhgap32	UTSW	9	32250641	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32261069	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32260680	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TAATACTTTGAAGGAAGCAGCAGC -3'
(R):5'- AGGGAGTCTTTTGTCAGCAC -3'

Sequencing Primer
(F):5'- CTCTGAAGTAGAGGGGAACA -3'
(R):5'- GGAGTCTTTTGTCAGCACAGAAC -3'

Posted On

2019-05-13