Incidental Mutation 'R1579:Nup214'
ID 171259
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Name nucleoporin 214
Synonyms CAN, D2H9S46E
MMRRC Submission 039616-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1579 (G1)
Quality Score 162
Status Not validated
Chromosome 2
Chromosomal Location 31864446-31943204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31924478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1669 (S1669F)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012]
AlphaFold Q80U93
Predicted Effect probably damaging
Transcript: ENSMUST00000065398
AA Change: S1669F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1669F

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123062
Predicted Effect possibly damaging
Transcript: ENSMUST00000138012
AA Change: S164F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S164F

DomainStartEndE-ValueType
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 137 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 181 210 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
low complexity region 294 327 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 373 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 544 572 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,724,039 (GRCm39) R162G probably benign Het
Adamtsl4 T A 3: 95,592,807 (GRCm39) probably benign Het
Adgrv1 A T 13: 81,711,898 (GRCm39) L306H probably damaging Het
Aknad1 T A 3: 108,659,452 (GRCm39) Y155* probably null Het
Aldh6a1 C T 12: 84,488,622 (GRCm39) R88H possibly damaging Het
Apc2 G C 10: 80,147,179 (GRCm39) K715N probably damaging Het
Arhgap45 G A 10: 79,864,811 (GRCm39) V798M probably damaging Het
Calcrl T C 2: 84,163,881 (GRCm39) T437A probably benign Het
Cdan1 A G 2: 120,561,220 (GRCm39) F183L probably damaging Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Cntnap4 A G 8: 113,608,462 (GRCm39) E1294G possibly damaging Het
Crybg3 C A 16: 59,350,561 (GRCm39) G2607V probably damaging Het
Dhx29 G T 13: 113,072,132 (GRCm39) probably null Het
Dmrtb1 T A 4: 107,541,322 (GRCm39) H13L probably damaging Het
Echdc2 A G 4: 108,031,006 (GRCm39) M162V probably benign Het
Entpd8 A G 2: 24,974,986 (GRCm39) D439G possibly damaging Het
Fastkd2 C G 1: 63,785,046 (GRCm39) H477Q probably null Het
Fbrs A G 7: 127,084,529 (GRCm39) E517G probably damaging Het
Gchfr A G 2: 119,002,502 (GRCm39) T71A possibly damaging Het
Hecw1 A T 13: 14,552,492 (GRCm39) C35S probably damaging Het
Izumo1r C T 9: 14,813,098 (GRCm39) R58H probably benign Het
Kif13a T C 13: 46,906,332 (GRCm39) E537G possibly damaging Het
Kif13b G A 14: 65,019,790 (GRCm39) probably null Het
Kremen1 CGGG CGGGGGG 11: 5,151,791 (GRCm39) probably benign Het
Lnpk A T 2: 74,378,340 (GRCm39) D140E probably damaging Het
Ltbp1 A G 17: 75,559,362 (GRCm39) M284V probably benign Het
Me3 A T 7: 89,495,050 (GRCm39) T323S possibly damaging Het
Mtus1 A G 8: 41,535,895 (GRCm39) V607A probably damaging Het
Myh14 A T 7: 44,305,118 (GRCm39) probably null Het
Myo1h T A 5: 114,485,496 (GRCm39) C545* probably null Het
Nbn T A 4: 15,964,289 (GRCm39) D121E probably damaging Het
Nox4 A G 7: 87,019,231 (GRCm39) Y408C probably damaging Het
Or10q1b A G 19: 13,682,566 (GRCm39) D125G probably damaging Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or5w20 G A 2: 87,727,286 (GRCm39) A248T probably benign Het
Osbpl5 T C 7: 143,262,939 (GRCm39) T150A possibly damaging Het
Pgap3 C A 11: 98,280,879 (GRCm39) M265I probably benign Het
Pirb A T 7: 3,720,637 (GRCm39) L287Q probably benign Het
Pkd2l2 A T 18: 34,560,446 (GRCm39) N351I possibly damaging Het
Prkdc T A 16: 15,493,192 (GRCm39) Y700N probably benign Het
Pzp A G 6: 128,500,931 (GRCm39) probably null Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rptor A T 11: 119,786,827 (GRCm39) Q1264L probably benign Het
Scnn1a T C 6: 125,299,103 (GRCm39) F61S probably damaging Het
Tenm2 C A 11: 35,997,610 (GRCm39) W825C probably damaging Het
Tex264 A T 9: 106,559,116 (GRCm39) I70N possibly damaging Het
Tns2 G T 15: 102,019,645 (GRCm39) D504Y probably damaging Het
Trappc14 T C 5: 138,260,128 (GRCm39) I338V probably benign Het
Trpc2 T A 7: 101,733,447 (GRCm39) F132Y probably damaging Het
Trpm4 A G 7: 44,958,021 (GRCm39) F816S probably damaging Het
Uqcc1 G A 2: 155,763,641 (GRCm39) Q5* probably null Het
Usp36 G T 11: 118,175,771 (GRCm39) T130N probably damaging Het
Vav1 A G 17: 57,604,252 (GRCm39) M165V probably benign Het
Vmn1r64 A T 7: 5,886,803 (GRCm39) F247I probably damaging Het
Vmn2r26 G C 6: 124,016,706 (GRCm39) R390P probably benign Het
Vmn2r57 G T 7: 41,049,548 (GRCm39) H734N probably benign Het
Wfdc16 G T 2: 164,477,843 (GRCm39) H69N possibly damaging Het
Zfp316 C T 5: 143,239,317 (GRCm39) E901K probably damaging Het
Zfp334 T C 2: 165,223,719 (GRCm39) E108G probably damaging Het
Zfp407 T C 18: 84,227,763 (GRCm39) S1949G probably benign Het
Zfp408 A G 2: 91,476,473 (GRCm39) L227P probably benign Het
Zfp560 T C 9: 20,259,287 (GRCm39) H525R possibly damaging Het
Zfp609 G A 9: 65,611,754 (GRCm39) A403V possibly damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 31,923,991 (GRCm39) missense probably damaging 1.00
IGL00649:Nup214 APN 2 31,896,733 (GRCm39) missense probably benign 0.27
IGL01149:Nup214 APN 2 31,924,712 (GRCm39) missense probably damaging 1.00
IGL01360:Nup214 APN 2 31,928,190 (GRCm39) unclassified probably benign
IGL01409:Nup214 APN 2 31,916,943 (GRCm39) splice site probably null
IGL01530:Nup214 APN 2 31,923,733 (GRCm39) missense probably benign
IGL01554:Nup214 APN 2 31,941,084 (GRCm39) nonsense probably null
IGL01944:Nup214 APN 2 31,924,971 (GRCm39) nonsense probably null
IGL02296:Nup214 APN 2 31,878,200 (GRCm39) missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31,867,872 (GRCm39) missense probably damaging 1.00
IGL02688:Nup214 APN 2 31,921,287 (GRCm39) missense probably benign
IGL02858:Nup214 APN 2 31,900,384 (GRCm39) splice site probably benign
IGL02953:Nup214 APN 2 31,878,241 (GRCm39) missense possibly damaging 0.87
IGL03090:Nup214 APN 2 31,908,254 (GRCm39) missense probably benign 0.01
IGL03124:Nup214 APN 2 31,886,452 (GRCm39) missense probably benign 0.27
IGL03225:Nup214 APN 2 31,924,423 (GRCm39) missense probably damaging 1.00
IGL03375:Nup214 APN 2 31,900,233 (GRCm39) missense probably damaging 0.97
Des_moines UTSW 2 31,870,596 (GRCm39) splice site probably null
ANU74:Nup214 UTSW 2 31,924,978 (GRCm39) missense probably damaging 0.99
R0035:Nup214 UTSW 2 31,880,379 (GRCm39) splice site probably null
R0243:Nup214 UTSW 2 31,888,069 (GRCm39) splice site probably benign
R0270:Nup214 UTSW 2 31,924,826 (GRCm39) missense probably damaging 0.96
R0358:Nup214 UTSW 2 31,894,312 (GRCm39) splice site probably null
R1168:Nup214 UTSW 2 31,915,313 (GRCm39) missense probably benign
R1242:Nup214 UTSW 2 31,867,782 (GRCm39) missense probably benign 0.00
R1481:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1482:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1580:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1581:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1610:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1894:Nup214 UTSW 2 31,886,392 (GRCm39) missense possibly damaging 0.66
R2146:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2149:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2293:Nup214 UTSW 2 31,916,887 (GRCm39) missense probably benign
R2924:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R2925:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R3037:Nup214 UTSW 2 31,866,632 (GRCm39) missense probably benign 0.00
R3426:Nup214 UTSW 2 31,923,415 (GRCm39) missense probably damaging 0.97
R3799:Nup214 UTSW 2 31,924,694 (GRCm39) missense probably damaging 1.00
R3843:Nup214 UTSW 2 31,941,112 (GRCm39) missense probably damaging 1.00
R4323:Nup214 UTSW 2 31,884,696 (GRCm39) missense probably benign
R4353:Nup214 UTSW 2 31,867,929 (GRCm39) critical splice donor site probably null
R4601:Nup214 UTSW 2 31,887,977 (GRCm39) missense probably benign 0.36
R4626:Nup214 UTSW 2 31,923,416 (GRCm39) missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31,870,596 (GRCm39) splice site probably null
R4938:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R4939:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R5027:Nup214 UTSW 2 31,881,329 (GRCm39) missense probably damaging 1.00
R5358:Nup214 UTSW 2 31,907,158 (GRCm39) missense unknown
R5406:Nup214 UTSW 2 31,892,619 (GRCm39) missense probably damaging 0.96
R5507:Nup214 UTSW 2 31,878,188 (GRCm39) missense possibly damaging 0.87
R5695:Nup214 UTSW 2 31,924,385 (GRCm39) missense probably damaging 1.00
R5744:Nup214 UTSW 2 31,900,308 (GRCm39) missense probably damaging 0.97
R5908:Nup214 UTSW 2 31,881,353 (GRCm39) missense probably benign 0.03
R5967:Nup214 UTSW 2 31,869,790 (GRCm39) missense possibly damaging 0.52
R6140:Nup214 UTSW 2 31,941,808 (GRCm39) missense possibly damaging 0.92
R6243:Nup214 UTSW 2 31,892,944 (GRCm39) missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31,881,384 (GRCm39) missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31,872,683 (GRCm39) nonsense probably null
R6970:Nup214 UTSW 2 31,941,810 (GRCm39) missense probably damaging 1.00
R7028:Nup214 UTSW 2 31,924,168 (GRCm39) missense probably benign 0.22
R7114:Nup214 UTSW 2 31,915,256 (GRCm39) missense possibly damaging 0.83
R7120:Nup214 UTSW 2 31,941,054 (GRCm39) missense probably benign 0.07
R7249:Nup214 UTSW 2 31,878,245 (GRCm39) missense possibly damaging 0.92
R7821:Nup214 UTSW 2 31,916,917 (GRCm39) missense possibly damaging 0.83
R8026:Nup214 UTSW 2 31,923,362 (GRCm39) missense possibly damaging 0.55
R8264:Nup214 UTSW 2 31,884,738 (GRCm39) missense possibly damaging 0.79
R8284:Nup214 UTSW 2 31,886,458 (GRCm39) missense possibly damaging 0.83
R8356:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8397:Nup214 UTSW 2 31,880,266 (GRCm39) missense probably damaging 0.96
R8456:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8785:Nup214 UTSW 2 31,924,465 (GRCm39) missense probably damaging 0.97
R9257:Nup214 UTSW 2 31,923,347 (GRCm39) missense possibly damaging 0.92
R9291:Nup214 UTSW 2 31,867,806 (GRCm39) missense probably benign 0.00
R9376:Nup214 UTSW 2 31,924,244 (GRCm39) missense probably benign 0.00
R9408:Nup214 UTSW 2 31,937,523 (GRCm39) missense probably damaging 1.00
R9613:Nup214 UTSW 2 31,901,035 (GRCm39) missense possibly damaging 0.90
R9789:Nup214 UTSW 2 31,907,227 (GRCm39) missense possibly damaging 0.46
RF015:Nup214 UTSW 2 31,924,718 (GRCm39) missense probably benign 0.00
X0026:Nup214 UTSW 2 31,910,318 (GRCm39) missense possibly damaging 0.46
X0065:Nup214 UTSW 2 31,932,488 (GRCm39) missense probably damaging 1.00
Z1088:Nup214 UTSW 2 31,901,235 (GRCm39) missense probably benign 0.27
Z1176:Nup214 UTSW 2 31,924,237 (GRCm39) nonsense probably null
Z1176:Nup214 UTSW 2 31,900,270 (GRCm39) missense possibly damaging 0.66
Z1177:Nup214 UTSW 2 31,887,971 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCATCTCTGCAAACTTCTGACCCTG -3'
(R):5'- AATGCTGTCTGTCCGAACACTCC -3'

Sequencing Primer
(F):5'- AGAACCTGTTCTTGTGCAGAC -3'
(R):5'- CTCCAGGAGCTGAAGCAC -3'
Posted On 2014-04-13