Incidental Mutation 'R1579:Zfp609'
ID171302
Institutional Source Beutler Lab
Gene Symbol Zfp609
Ensembl Gene ENSMUSG00000040524
Gene Namezinc finger protein 609
Synonyms
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65692391-65827564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65704472 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 403 (A403V)
Ref Sequence ENSEMBL: ENSMUSP00000124089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159109
AA Change: A403V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124089
Gene: ENSMUSG00000040524
AA Change: A403V

DomainStartEndE-ValueType
low complexity region 83 101 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 386 405 N/A INTRINSIC
ZnF_C2H2 495 520 2.14e0 SMART
low complexity region 629 638 N/A INTRINSIC
low complexity region 657 667 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 1000 1020 N/A INTRINSIC
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
low complexity region 1329 1348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159878
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Other mutations in Zfp609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Zfp609 APN 9 65702763 missense probably benign 0.18
IGL01688:Zfp609 APN 9 65704025 missense probably benign
IGL01718:Zfp609 APN 9 65702400 nonsense probably null
IGL01860:Zfp609 APN 9 65702834 missense possibly damaging 0.82
IGL02441:Zfp609 APN 9 65703329 missense possibly damaging 0.92
IGL02490:Zfp609 APN 9 65703968 missense possibly damaging 0.92
IGL02614:Zfp609 APN 9 65702790 missense probably damaging 0.96
IGL02794:Zfp609 APN 9 65704320 missense possibly damaging 0.83
IGL02959:Zfp609 APN 9 65703393 missense probably benign
IGL02967:Zfp609 APN 9 65697619 missense possibly damaging 0.83
IGL03036:Zfp609 APN 9 65702645 missense possibly damaging 0.89
IGL03182:Zfp609 APN 9 65701005 missense probably benign 0.02
H8441:Zfp609 UTSW 9 65794887 missense possibly damaging 0.82
R0304:Zfp609 UTSW 9 65701188 missense possibly damaging 0.89
R0487:Zfp609 UTSW 9 65702634 missense unknown
R0505:Zfp609 UTSW 9 65703462 missense possibly damaging 0.92
R0684:Zfp609 UTSW 9 65731201 missense probably benign 0.01
R1480:Zfp609 UTSW 9 65703311 missense possibly damaging 0.82
R1507:Zfp609 UTSW 9 65794777 missense possibly damaging 0.92
R1655:Zfp609 UTSW 9 65703554 missense possibly damaging 0.46
R1692:Zfp609 UTSW 9 65795311 missense probably damaging 0.98
R1701:Zfp609 UTSW 9 65731000 missense probably benign 0.05
R1735:Zfp609 UTSW 9 65703092 nonsense probably null
R1883:Zfp609 UTSW 9 65794758 missense probably benign
R1970:Zfp609 UTSW 9 65795277 missense probably damaging 0.96
R2059:Zfp609 UTSW 9 65704434 missense possibly damaging 0.83
R2302:Zfp609 UTSW 9 65794897 missense possibly damaging 0.66
R3404:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R3405:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R4514:Zfp609 UTSW 9 65703695 missense possibly damaging 0.46
R4533:Zfp609 UTSW 9 65703608 missense probably benign 0.00
R5043:Zfp609 UTSW 9 65700827 missense probably damaging 0.97
R5499:Zfp609 UTSW 9 65702855 missense probably benign 0.00
X0028:Zfp609 UTSW 9 65697080 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACAAGAGTGGGTTCTACCTTGGTC -3'
(R):5'- CAGTTCCCGTGCAGGTTCCTAAAG -3'

Sequencing Primer
(F):5'- TTGTACGGACACGCTTGC -3'
(R):5'- tcaggaggcagaggcag -3'
Posted On2014-04-13