Incidental Mutation 'R1186:Isyna1'
ID 102132
Institutional Source Beutler Lab
Gene Symbol Isyna1
Ensembl Gene ENSMUSG00000019139
Gene Name myo-inositol 1-phosphate synthase A1
Synonyms
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 70594373-70597290 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70595201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 115 (N115K)
Ref Sequence ENSEMBL: ENSMUSP00000148077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019283] [ENSMUST00000049908] [ENSMUST00000093454] [ENSMUST00000209285] [ENSMUST00000210005] [ENSMUST00000210369] [ENSMUST00000211117] [ENSMUST00000210580] [ENSMUST00000211197] [ENSMUST00000211608]
AlphaFold Q9JHU9
Predicted Effect probably benign
Transcript: ENSMUST00000019283
AA Change: N115K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019283
Gene: ENSMUSG00000019139
AA Change: N115K

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:NAD_binding_5 59 491 4.4e-141 PFAM
Pfam:Inos-1-P_synth 307 420 6.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049908
SMART Domains Protein: ENSMUSP00000059039
Gene: ENSMUSG00000070003

DomainStartEndE-ValueType
LisH 16 48 2.18e-3 SMART
Pfam:SSDP 81 123 6.7e-15 PFAM
Pfam:SSDP 121 338 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093454
SMART Domains Protein: ENSMUSP00000091163
Gene: ENSMUSG00000070002

DomainStartEndE-ValueType
Pfam:ELL 6 289 2.2e-107 PFAM
low complexity region 403 416 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
low complexity region 447 471 N/A INTRINSIC
Pfam:Occludin_ELL 494 595 6.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209285
AA Change: N115K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209751
Predicted Effect probably benign
Transcript: ENSMUST00000210005
AA Change: N115K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210358
Predicted Effect probably benign
Transcript: ENSMUST00000210369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210382
Predicted Effect probably benign
Transcript: ENSMUST00000211117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210878
Predicted Effect probably benign
Transcript: ENSMUST00000210580
Predicted Effect probably benign
Transcript: ENSMUST00000211197
Predicted Effect probably benign
Transcript: ENSMUST00000211501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211134
Predicted Effect probably benign
Transcript: ENSMUST00000211608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210699
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inositol-3-phosphate synthase enzyme. The encoded protein plays a critical role in the myo-inositol biosynthesis pathway by catalyzing the rate-limiting conversion of glucose 6-phosphate to myoinositol 1-phosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Isyna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Isyna1 APN 8 70594722 missense probably damaging 0.98
IGL01670:Isyna1 APN 8 70597056 missense probably benign 0.00
IGL02003:Isyna1 APN 8 70596757 missense possibly damaging 0.94
IGL02321:Isyna1 APN 8 70596270 missense probably damaging 1.00
IGL02649:Isyna1 APN 8 70596254 missense probably damaging 1.00
R0629:Isyna1 UTSW 8 70594708 missense probably damaging 1.00
R0976:Isyna1 UTSW 8 70596286 missense probably damaging 1.00
R4869:Isyna1 UTSW 8 70596762 missense possibly damaging 0.80
R4901:Isyna1 UTSW 8 70596596 missense probably damaging 1.00
R4941:Isyna1 UTSW 8 70595496 missense probably damaging 1.00
R5141:Isyna1 UTSW 8 70594893 missense probably damaging 1.00
R5719:Isyna1 UTSW 8 70594702 missense probably damaging 1.00
R6500:Isyna1 UTSW 8 70594689 missense probably damaging 1.00
R8095:Isyna1 UTSW 8 70596385 nonsense probably null
R8957:Isyna1 UTSW 8 70596722 missense probably damaging 0.99
R9479:Isyna1 UTSW 8 70595543 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTCTTCCTTAGGTGCAGCCCAG -3'
(R):5'- AGGTTCAGCGACGAGATATCCCAG -3'

Sequencing Primer
(F):5'- AATCGGCTGCGCCTAAC -3'
(R):5'- GCTTTGCCCACCATCAAACA -3'
Posted On 2014-01-15