Incidental Mutation 'R1550:Arhgap21'
ID169819
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1550 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 20881765 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 39 (Y39*)
Ref Sequence ENSEMBL: ENSMUSP00000133347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect probably null
Transcript: ENSMUST00000114594
AA Change: Y204*
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: Y204*

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141298
AA Change: Y210*
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: Y210*

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154230
AA Change: Y210*
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: Y210*

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156142
Predicted Effect probably null
Transcript: ENSMUST00000173194
AA Change: Y200*
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: Y200*

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174584
AA Change: Y39*
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: Y39*

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
R7965:Arhgap21 UTSW 2 20849196 missense probably damaging 1.00
R7986:Arhgap21 UTSW 2 20863156 missense probably damaging 1.00
R8028:Arhgap21 UTSW 2 20880405 missense probably benign 0.02
R8209:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8226:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8251:Arhgap21 UTSW 2 20849410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAAGGCACAATGACGGTCCTC -3'
(R):5'- CGCGCCACAGTGAGTATCATTCAG -3'

Sequencing Primer
(F):5'- AACACACACTGCTGTGTTTGAC -3'
(R):5'- CAGTGAGTATCATTCAGGATTAAGG -3'
Posted On2014-04-13