Incidental Mutation 'R1645:Dyrk4'
ID173812
Institutional Source Beutler Lab
Gene Symbol Dyrk4
Ensembl Gene ENSMUSG00000030345
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
SynonymsDyrk4a, Dyrk4b
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location126876020-126921839 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 126894793 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 171 (E171*)
Ref Sequence ENSEMBL: ENSMUSP00000077606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078521]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032495
Predicted Effect probably null
Transcript: ENSMUST00000078521
AA Change: E171*
SMART Domains Protein: ENSMUSP00000077606
Gene: ENSMUSG00000030345
AA Change: E171*

DomainStartEndE-ValueType
S_TKc 219 515 2.9e-84 SMART
low complexity region 555 573 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Contrary to expectation, homozygous null males are fertile and do not exhibit any obvious dysfunction in spermatogenesis, sperm motility and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Dyrk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02474:Dyrk4 APN 6 126880231 missense probably damaging 1.00
IGL02598:Dyrk4 APN 6 126884019 intron probably benign
IGL02697:Dyrk4 APN 6 126899008 missense possibly damaging 0.88
IGL03127:Dyrk4 APN 6 126897171 missense possibly damaging 0.92
IGL03229:Dyrk4 APN 6 126886642 unclassified probably benign
IGL03248:Dyrk4 APN 6 126884053 missense probably benign 0.05
R0597:Dyrk4 UTSW 6 126886649 splice site probably null
R0862:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R0864:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1650:Dyrk4 UTSW 6 126899829 missense probably benign 0.28
R1885:Dyrk4 UTSW 6 126877181 missense probably benign 0.15
R3947:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3948:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3949:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R4794:Dyrk4 UTSW 6 126885337 missense possibly damaging 0.79
R5991:Dyrk4 UTSW 6 126880225 missense probably benign 0.44
R6143:Dyrk4 UTSW 6 126886651 critical splice donor site probably null
R6269:Dyrk4 UTSW 6 126886727 missense probably damaging 1.00
R6572:Dyrk4 UTSW 6 126897238 missense probably benign
R6598:Dyrk4 UTSW 6 126876326 missense probably benign 0.20
R6703:Dyrk4 UTSW 6 126890082 missense probably damaging 1.00
R6750:Dyrk4 UTSW 6 126898955 missense probably benign 0.00
R7214:Dyrk4 UTSW 6 126885237 missense probably benign 0.35
R7585:Dyrk4 UTSW 6 126890044 missense probably damaging 1.00
R8101:Dyrk4 UTSW 6 126891649 missense possibly damaging 0.87
R8203:Dyrk4 UTSW 6 126894834 missense probably damaging 1.00
Z1176:Dyrk4 UTSW 6 126892128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGGGAAACCTATCCCACCGTG -3'
(R):5'- CCAGTCTGCTGTTTCAGTGTGACC -3'

Sequencing Primer
(F):5'- AGTACTGCAAAATATCCCCTTTCTG -3'
(R):5'- ATACCCCTGCAACTGAACTG -3'
Posted On2014-04-24