Incidental Mutation 'R1657:Esam'
ID 186465
Institutional Source Beutler Lab
Gene Symbol Esam
Ensembl Gene ENSMUSG00000001946
Gene Name endothelial cell-specific adhesion molecule
Synonyms W117m, 2310008D05Rik
MMRRC Submission 039693-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R1657 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 37439385-37449615 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37448917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 342 (S342P)
Ref Sequence ENSEMBL: ENSMUSP00000002011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002008] [ENSMUST00000002011] [ENSMUST00000123198] [ENSMUST00000146860] [ENSMUST00000214142] [ENSMUST00000215271] [ENSMUST00000213699] [ENSMUST00000215957]
AlphaFold Q925F2
Predicted Effect probably benign
Transcript: ENSMUST00000002008
SMART Domains Protein: ENSMUSP00000002008
Gene: ENSMUSG00000001943

DomainStartEndE-ValueType
IGv 41 124 4.03e-8 SMART
IGc2 158 225 1.06e-7 SMART
transmembrane domain 243 265 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000002011
AA Change: S342P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002011
Gene: ENSMUSG00000001946
AA Change: S342P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 39 153 4.82e-6 SMART
IGc2 168 234 1.17e-4 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123198
SMART Domains Protein: ENSMUSP00000116300
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
Blast:IG 9 72 1e-40 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131832
Predicted Effect probably benign
Transcript: ENSMUST00000146860
SMART Domains Protein: ENSMUSP00000122473
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
IG 9 123 4.82e-6 SMART
IGc2 138 204 1.17e-4 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215710
Predicted Effect probably benign
Transcript: ENSMUST00000214142
Predicted Effect probably benign
Transcript: ENSMUST00000215271
Predicted Effect probably benign
Transcript: ENSMUST00000213699
Predicted Effect probably benign
Transcript: ENSMUST00000215957
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhbit a decrease in body weight, impaired neutrophil transmigration and decreased immune and VEGF-stimulated vascular permeability. Tumor growth is inhibited due to decreased pathological angiogenesis in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,910 (GRCm39) D988E probably benign Het
Als2 A G 1: 59,219,760 (GRCm39) V1185A probably damaging Het
Amdhd2 A G 17: 24,375,029 (GRCm39) V391A probably damaging Het
Armh4 G C 14: 50,011,017 (GRCm39) T230S probably damaging Het
Caprin1 A T 2: 103,599,851 (GRCm39) V608E probably damaging Het
Celsr3 T A 9: 108,720,151 (GRCm39) C2512* probably null Het
Cfl1 A T 19: 5,543,583 (GRCm39) R187W probably damaging Het
Cgnl1 C T 9: 71,633,226 (GRCm39) V42I probably damaging Het
Chd2 A G 7: 73,130,178 (GRCm39) Y826H probably damaging Het
Col9a2 C A 4: 120,898,171 (GRCm39) P28T unknown Het
Cyp3a44 G A 5: 145,716,553 (GRCm39) P346S probably damaging Het
Dact2 A G 17: 14,418,252 (GRCm39) V151A probably benign Het
Dhx29 T C 13: 113,089,377 (GRCm39) I716T probably damaging Het
Entrep1 C A 19: 23,952,999 (GRCm39) C437F probably damaging Het
Fer1l4 A G 2: 155,877,518 (GRCm39) V1053A possibly damaging Het
Grk3 A G 5: 113,114,848 (GRCm39) F124S probably damaging Het
H2-DMa G A 17: 34,356,373 (GRCm39) probably null Het
Hsd3b5 T A 3: 98,527,036 (GRCm39) I137F possibly damaging Het
Itgav A T 2: 83,632,123 (GRCm39) I902F probably benign Het
Itsn1 G T 16: 91,706,111 (GRCm39) C179F probably damaging Het
Kcnh8 G A 17: 53,146,153 (GRCm39) R347H probably damaging Het
Kif9 T C 9: 110,319,034 (GRCm39) M166T possibly damaging Het
Kmt5c C T 7: 4,749,453 (GRCm39) Q324* probably null Het
Lcn9 G A 2: 25,714,722 (GRCm39) E154K probably benign Het
Mfge8 A T 7: 78,791,521 (GRCm39) L227Q probably benign Het
Mroh2b A T 15: 4,960,525 (GRCm39) R753* probably null Het
Mtif2 G A 11: 29,490,721 (GRCm39) R475Q probably benign Het
Nln C T 13: 104,173,455 (GRCm39) V584I possibly damaging Het
Nr2e3 T C 9: 59,856,050 (GRCm39) E129G probably benign Het
Ocstamp T C 2: 165,239,436 (GRCm39) D250G probably damaging Het
Or1a1 A T 11: 74,086,722 (GRCm39) H131L probably damaging Het
Or52n4b T C 7: 108,144,584 (GRCm39) I284T possibly damaging Het
Or8k27 A C 2: 86,275,562 (GRCm39) L255V probably damaging Het
Pld1 A T 3: 28,125,336 (GRCm39) I417L probably benign Het
Polr1a A T 6: 71,918,519 (GRCm39) K692N probably damaging Het
Qsox2 A T 2: 26,110,759 (GRCm39) Y152* probably null Het
Rpap1 T C 2: 119,614,259 (GRCm39) D46G possibly damaging Het
Rpe65 A G 3: 159,320,085 (GRCm39) T246A probably damaging Het
Scn5a T C 9: 119,391,446 (GRCm39) D82G probably damaging Het
Sema3d A G 5: 12,634,941 (GRCm39) E669G possibly damaging Het
Serpinb6c T C 13: 34,064,209 (GRCm39) N282S probably benign Het
Snap47 A T 11: 59,319,596 (GRCm39) S181T probably benign Het
Snx9 A C 17: 5,968,711 (GRCm39) T336P possibly damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Terb1 A T 8: 105,215,123 (GRCm39) D284E possibly damaging Het
Tmem266 C T 9: 55,325,292 (GRCm39) A153V probably damaging Het
Trappc2b T C 11: 51,576,505 (GRCm39) Q131R probably benign Het
Ttn T C 2: 76,573,148 (GRCm39) E25915G possibly damaging Het
Tubal3 A G 13: 3,983,011 (GRCm39) T264A possibly damaging Het
Vldlr G A 19: 27,223,070 (GRCm39) R747Q probably benign Het
Zc3h8 G T 2: 128,771,877 (GRCm39) probably benign Het
Zfp184 C T 13: 22,143,443 (GRCm39) T383M probably damaging Het
Zfp455 T C 13: 67,346,703 (GRCm39) F38S possibly damaging Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp985 T A 4: 147,668,567 (GRCm39) N478K probably benign Het
Other mutations in Esam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03180:Esam APN 9 37,445,866 (GRCm39) missense probably damaging 0.99
IGL03408:Esam APN 9 37,445,949 (GRCm39) missense possibly damaging 0.52
R0755:Esam UTSW 9 37,447,998 (GRCm39) missense probably damaging 0.98
R2349:Esam UTSW 9 37,439,527 (GRCm39) missense probably benign
R3418:Esam UTSW 9 37,448,426 (GRCm39) splice site probably null
R4373:Esam UTSW 9 37,445,492 (GRCm39) missense probably benign
R4669:Esam UTSW 9 37,447,952 (GRCm39) nonsense probably null
R6175:Esam UTSW 9 37,439,544 (GRCm39) missense probably benign 0.01
R6357:Esam UTSW 9 37,449,076 (GRCm39) makesense probably null
R7293:Esam UTSW 9 37,449,020 (GRCm39) missense probably damaging 1.00
R7472:Esam UTSW 9 37,448,863 (GRCm39) missense possibly damaging 0.77
R7953:Esam UTSW 9 37,448,317 (GRCm39) missense probably damaging 0.99
R8043:Esam UTSW 9 37,448,317 (GRCm39) missense probably damaging 0.99
R8336:Esam UTSW 9 37,448,362 (GRCm39) missense probably benign 0.37
R8790:Esam UTSW 9 37,442,927 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCAGGGAAGATGCCATTGC -3'
(R):5'- TCCCAAGATTGAGTCCTCTGTGCC -3'

Sequencing Primer
(F):5'- GAAGATGCCATTGCTCCCC -3'
(R):5'- TACCAGATGTAGCTAATGAGTGCC -3'
Posted On 2014-05-09