Incidental Mutation 'R1691:Garnl3'
ID191761
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 039724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R1691 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 32997663 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 778 (Y778*)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]
Predicted Effect probably null
Transcript: ENSMUST00000049618
AA Change: Y737*
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: Y737*

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102810
AA Change: Y733*
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: Y733*

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137381
AA Change: Y778*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193214
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,499,606 S283P probably damaging Het
Adck2 T A 6: 39,574,968 L223* probably null Het
Ank T C 15: 27,590,944 W390R probably damaging Het
Ano5 T C 7: 51,590,579 Y752H probably damaging Het
Apcs T A 1: 172,894,593 D62V probably damaging Het
Atad5 A G 11: 80,095,532 T482A probably benign Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Ccdc13 A T 9: 121,825,068 probably null Het
Ccdc157 G A 11: 4,149,030 P159S probably benign Het
Cdhr3 C T 12: 33,082,247 V126M probably damaging Het
Cdr1 T C X: 61,184,174 D462G possibly damaging Het
Cisd1 A G 10: 71,344,729 V9A probably benign Het
Col19a1 T C 1: 24,536,941 R107G unknown Het
Col1a2 C A 6: 4,536,038 H972Q unknown Het
Col3a1 T A 1: 45,348,616 probably benign Het
Dbnl A G 11: 5,797,174 S235G probably null Het
Dock4 T A 12: 40,725,755 S566T probably benign Het
Efcab6 T C 15: 83,933,206 D722G probably benign Het
Esyt1 T C 10: 128,525,534 Q97R probably benign Het
Fam196a C T 7: 134,918,286 A172T probably damaging Het
Fat2 G A 11: 55,311,852 T132I probably damaging Het
Fgd2 C T 17: 29,378,944 Q618* probably null Het
Flnc T A 6: 29,441,214 V389E probably benign Het
Gpaa1 A T 15: 76,332,216 Y45F probably damaging Het
Grid1 A T 14: 35,452,329 I643F probably damaging Het
Gsdmc2 T C 15: 63,833,465 D133G probably damaging Het
Hp T C 8: 109,575,572 D248G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna13 T C 4: 88,644,054 D111G probably benign Het
Il9r T A 11: 32,191,829 Q309L possibly damaging Het
Ints1 A T 5: 139,768,932 D617E probably damaging Het
Kcnj12 A T 11: 61,070,277 N467I possibly damaging Het
Kmt2e T A 5: 23,464,849 D111E probably damaging Het
Lama4 A G 10: 39,080,563 K1161E probably benign Het
Lamc1 C T 1: 153,247,249 D732N probably benign Het
Larp1 A G 11: 58,048,048 T517A probably benign Het
Lrp12 A G 15: 39,872,265 I757T probably damaging Het
Max T C 12: 76,953,272 D23G possibly damaging Het
Nars A T 18: 64,516,414 probably null Het
Nipsnap3a G A 4: 52,994,185 D91N probably null Het
Nphp3 A G 9: 104,002,811 T11A probably benign Het
Nr2c2 C A 6: 92,156,692 T226K probably damaging Het
Nrxn1 A G 17: 90,162,289 I1288T probably damaging Het
Nt5c1b C T 12: 10,375,537 T360I possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1281 G A 2: 111,328,853 V145I probably benign Het
Olfr1505 C T 19: 13,919,419 T133I probably benign Het
Olfr1508 A T 14: 52,463,831 H59Q possibly damaging Het
Olfr214 A G 6: 116,556,577 T51A probably benign Het
Olfr516 A G 7: 108,845,141 Y290H possibly damaging Het
Olfr532 A T 7: 140,418,942 L277Q probably damaging Het
Pcsk1 A G 13: 75,132,225 D723G possibly damaging Het
Phrf1 C A 7: 141,261,874 Y715* probably null Het
Pigm T C 1: 172,376,787 V30A probably benign Het
Pkd1l2 A T 8: 117,056,419 F721I possibly damaging Het
Pla2g15 A G 8: 106,154,949 D70G possibly damaging Het
Prl7d1 A T 13: 27,709,382 I182N probably damaging Het
Prss23 T C 7: 89,510,714 K49R probably benign Het
Rps6 A T 4: 86,856,809 D19E probably benign Het
Slco6d1 A T 1: 98,507,567 H669L probably benign Het
Svil G T 18: 5,056,336 C490F probably benign Het
Tom1 T C 8: 75,051,599 I103T probably damaging Het
Trim10 T A 17: 36,876,899 Y336N probably damaging Het
Trim43c G T 9: 88,840,699 V133F probably damaging Het
Tvp23a A G 16: 10,428,687 L78P possibly damaging Het
Ugt2b38 T A 5: 87,424,132 I14L probably benign Het
Unc5a A C 13: 55,002,924 M520L probably damaging Het
Vmn1r174 T A 7: 23,753,912 M1K probably null Het
Vmn2r58 C T 7: 41,837,489 G661R possibly damaging Het
Vps41 A C 13: 18,841,243 D471A probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp462 T A 4: 55,013,489 F1818L possibly damaging Het
Zp3 G A 5: 135,980,281 E50K possibly damaging Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
R8940:Garnl3 UTSW 2 33005229 critical splice acceptor site probably null
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGTAGCAGGCATTGTCAGCCC -3'
(R):5'- ACAACCCTCAGAATTTGGCCCG -3'

Sequencing Primer
(F):5'- CCCGGCTTGAGGATTTTAGAAAAG -3'
(R):5'- gtaatcccagcaggtgagaag -3'
Posted On2014-05-14