Mutagenetix > Incidental Mutation

Incidental Mutation 'R1691:Garnl3'

191761

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

039724-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R1691 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 32997663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 778 (Y778*)

Ref Sequence

ENSEMBL: ENSMUSP00000122576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]

AlphaFold

Q3V0G7

Predicted Effect

probably null
Transcript: ENSMUST00000049618
AA Change: Y737*

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: Y737*

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102810
AA Change: Y733*

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: Y733*

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137381
AA Change: Y778*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193214

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	T	C	7: 82,499,606	S283P	probably damaging	Het
Adck2	T	A	6: 39,574,968	L223*	probably null	Het
Ank	T	C	15: 27,590,944	W390R	probably damaging	Het
Ano5	T	C	7: 51,590,579	Y752H	probably damaging	Het
Apcs	T	A	1: 172,894,593	D62V	probably damaging	Het
Atad5	A	G	11: 80,095,532	T482A	probably benign	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Ccdc13	A	T	9: 121,825,068		probably null	Het
Ccdc157	G	A	11: 4,149,030	P159S	probably benign	Het
Cdhr3	C	T	12: 33,082,247	V126M	probably damaging	Het
Cdr1	T	C	X: 61,184,174	D462G	possibly damaging	Het
Cisd1	A	G	10: 71,344,729	V9A	probably benign	Het
Col19a1	T	C	1: 24,536,941	R107G	unknown	Het
Col1a2	C	A	6: 4,536,038	H972Q	unknown	Het
Col3a1	T	A	1: 45,348,616		probably benign	Het
Dbnl	A	G	11: 5,797,174	S235G	probably null	Het
Dock4	T	A	12: 40,725,755	S566T	probably benign	Het
Efcab6	T	C	15: 83,933,206	D722G	probably benign	Het
Esyt1	T	C	10: 128,525,534	Q97R	probably benign	Het
Fam196a	C	T	7: 134,918,286	A172T	probably damaging	Het
Fat2	G	A	11: 55,311,852	T132I	probably damaging	Het
Fgd2	C	T	17: 29,378,944	Q618*	probably null	Het
Flnc	T	A	6: 29,441,214	V389E	probably benign	Het
Gpaa1	A	T	15: 76,332,216	Y45F	probably damaging	Het
Grid1	A	T	14: 35,452,329	I643F	probably damaging	Het
Gsdmc2	T	C	15: 63,833,465	D133G	probably damaging	Het
Hp	T	C	8: 109,575,572	D248G	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna13	T	C	4: 88,644,054	D111G	probably benign	Het
Il9r	T	A	11: 32,191,829	Q309L	possibly damaging	Het
Ints1	A	T	5: 139,768,932	D617E	probably damaging	Het
Kcnj12	A	T	11: 61,070,277	N467I	possibly damaging	Het
Kmt2e	T	A	5: 23,464,849	D111E	probably damaging	Het
Lama4	A	G	10: 39,080,563	K1161E	probably benign	Het
Lamc1	C	T	1: 153,247,249	D732N	probably benign	Het
Larp1	A	G	11: 58,048,048	T517A	probably benign	Het
Lrp12	A	G	15: 39,872,265	I757T	probably damaging	Het
Max	T	C	12: 76,953,272	D23G	possibly damaging	Het
Nars	A	T	18: 64,516,414		probably null	Het
Nipsnap3a	G	A	4: 52,994,185	D91N	probably null	Het
Nphp3	A	G	9: 104,002,811	T11A	probably benign	Het
Nr2c2	C	A	6: 92,156,692	T226K	probably damaging	Het
Nrxn1	A	G	17: 90,162,289	I1288T	probably damaging	Het
Nt5c1b	C	T	12: 10,375,537	T360I	possibly damaging	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1281	G	A	2: 111,328,853	V145I	probably benign	Het
Olfr1505	C	T	19: 13,919,419	T133I	probably benign	Het
Olfr1508	A	T	14: 52,463,831	H59Q	possibly damaging	Het
Olfr214	A	G	6: 116,556,577	T51A	probably benign	Het
Olfr516	A	G	7: 108,845,141	Y290H	possibly damaging	Het
Olfr532	A	T	7: 140,418,942	L277Q	probably damaging	Het
Pcsk1	A	G	13: 75,132,225	D723G	possibly damaging	Het
Phrf1	C	A	7: 141,261,874	Y715*	probably null	Het
Pigm	T	C	1: 172,376,787	V30A	probably benign	Het
Pkd1l2	A	T	8: 117,056,419	F721I	possibly damaging	Het
Pla2g15	A	G	8: 106,154,949	D70G	possibly damaging	Het
Prl7d1	A	T	13: 27,709,382	I182N	probably damaging	Het
Prss23	T	C	7: 89,510,714	K49R	probably benign	Het
Rps6	A	T	4: 86,856,809	D19E	probably benign	Het
Slco6d1	A	T	1: 98,507,567	H669L	probably benign	Het
Svil	G	T	18: 5,056,336	C490F	probably benign	Het
Tom1	T	C	8: 75,051,599	I103T	probably damaging	Het
Trim10	T	A	17: 36,876,899	Y336N	probably damaging	Het
Trim43c	G	T	9: 88,840,699	V133F	probably damaging	Het
Tvp23a	A	G	16: 10,428,687	L78P	possibly damaging	Het
Ugt2b38	T	A	5: 87,424,132	I14L	probably benign	Het
Unc5a	A	C	13: 55,002,924	M520L	probably damaging	Het
Vmn1r174	T	A	7: 23,753,912	M1K	probably null	Het
Vmn2r58	C	T	7: 41,837,489	G661R	possibly damaging	Het
Vps41	A	C	13: 18,841,243	D471A	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp462	T	A	4: 55,013,489	F1818L	possibly damaging	Het
Zp3	G	A	5: 135,980,281	E50K	possibly damaging	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8087:Garnl3	UTSW	2	33045536	missense	probably benign	0.01
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
R8679:Garnl3	UTSW	2	33026094	missense	probably damaging	1.00
R8940:Garnl3	UTSW	2	33005229	critical splice acceptor site	probably null
R9081:Garnl3	UTSW	2	33006908	missense	possibly damaging	0.90
R9183:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9213:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9219:Garnl3	UTSW	2	33085886	missense	probably damaging	1.00
R9453:Garnl3	UTSW	2	33003869	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCAGTAGCAGGCATTGTCAGCCC -3'
(R):5'- ACAACCCTCAGAATTTGGCCCG -3'

Sequencing Primer
(F):5'- CCCGGCTTGAGGATTTTAGAAAAG -3'
(R):5'- gtaatcccagcaggtgagaag -3'

Posted On

2014-05-14