Incidental Mutation 'R7401:Gmeb1'
ID 574156
Institutional Source Beutler Lab
Gene Symbol Gmeb1
Ensembl Gene ENSMUSG00000028901
Gene Name glucocorticoid modulatory element binding protein 1
Synonyms 1110050A04Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 132221025-132261602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 132225774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 560 (L560F)
Ref Sequence ENSEMBL: ENSMUSP00000030733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030733] [ENSMUST00000105964] [ENSMUST00000105965] [ENSMUST00000168553]
AlphaFold Q9JL60
Predicted Effect probably damaging
Transcript: ENSMUST00000030733
AA Change: L560F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030733
Gene: ENSMUSG00000028901
AA Change: L560F

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105964
AA Change: L560F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101584
Gene: ENSMUSG00000028901
AA Change: L560F

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105965
AA Change: L560F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101585
Gene: ENSMUSG00000028901
AA Change: L560F

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168553
AA Change: L560F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131331
Gene: ENSMUSG00000028901
AA Change: L560F

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Three alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adamts3 T A 5: 89,707,450 probably null Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Cast G T 13: 74,808,458 A18E unknown Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fam193a A G 5: 34,465,635 E1189G possibly damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Hace1 T C 10: 45,670,626 L452P probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc119 T C 11: 78,347,245 I83T probably benign Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Vmn2r111 G T 17: 22,571,086 T313K possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Gmeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Gmeb1 APN 4 132227985 missense probably benign 0.00
IGL02089:Gmeb1 APN 4 132225836 missense probably damaging 1.00
R0137:Gmeb1 UTSW 4 132232108 missense probably benign 0.01
R0326:Gmeb1 UTSW 4 132242352 missense probably damaging 0.98
R0611:Gmeb1 UTSW 4 132226075 nonsense probably null
R0898:Gmeb1 UTSW 4 132234782 missense probably benign 0.01
R1317:Gmeb1 UTSW 4 132234887 nonsense probably null
R1453:Gmeb1 UTSW 4 132242448 missense possibly damaging 0.56
R1573:Gmeb1 UTSW 4 132251740 missense probably benign 0.12
R1751:Gmeb1 UTSW 4 132234887 nonsense probably null
R1754:Gmeb1 UTSW 4 132232027 missense probably benign
R1761:Gmeb1 UTSW 4 132234887 nonsense probably null
R5203:Gmeb1 UTSW 4 132232009 splice site probably null
R6241:Gmeb1 UTSW 4 132242377 missense possibly damaging 0.64
R6241:Gmeb1 UTSW 4 132246013 missense probably benign 0.00
R7103:Gmeb1 UTSW 4 132234868 missense probably damaging 0.99
R7192:Gmeb1 UTSW 4 132227890 missense probably benign 0.03
R7528:Gmeb1 UTSW 4 132232050 missense possibly damaging 0.49
R9055:Gmeb1 UTSW 4 132237114 missense probably damaging 1.00
R9317:Gmeb1 UTSW 4 132226038 missense probably benign 0.45
R9442:Gmeb1 UTSW 4 132234845 missense probably damaging 0.99
R9559:Gmeb1 UTSW 4 132225829 missense probably benign 0.21
R9644:Gmeb1 UTSW 4 132232129 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGCAGCTTGTTCTGTCC -3'
(R):5'- GTTGAAAGCACCTCTGAGGATG -3'

Sequencing Primer
(F):5'- CTGTCCAGTTGTCAATGAGGAAG -3'
(R):5'- TGGGCAGACCATCATTGAAATC -3'
Posted On 2019-09-13