Mutagenetix > Incidental Mutation

Incidental Mutation 'R0089:Mpp7'

20100

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

038376-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R0089 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 7439555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000115869

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 90.5%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,292,886	V1583E	possibly damaging	Het
Ablim1	G	T	19: 57,043,031	S654Y	probably damaging	Het
Acbd4	T	C	11: 103,103,993	F59S	probably damaging	Het
Acot1	T	C	12: 84,016,934	I272T	probably damaging	Het
Ankhd1	A	G	18: 36,640,356	D1402G	probably damaging	Het
Birc6	T	A	17: 74,638,376	F2800I	possibly damaging	Het
Brd1	T	C	15: 88,701,198	E811G	probably benign	Het
Ccdc106	A	G	7: 5,056,221		probably null	Het
Ccdc81	G	T	7: 89,893,116	A184E	possibly damaging	Het
Cenpt	T	C	8: 105,846,368	T364A	probably benign	Het
Crybg2	T	C	4: 134,081,194	S1060P	probably damaging	Het
Dnttip2	A	G	3: 122,275,462	T109A	possibly damaging	Het
Dpy19l2	A	G	9: 24,695,793	L124P	probably benign	Het
Fat3	T	C	9: 15,938,205	D3967G	probably benign	Het
Fbxo21	T	A	5: 118,008,143	F610L	probably benign	Het
Fmo9	T	C	1: 166,667,309	D341G	probably benign	Het
Frem3	A	T	8: 80,615,878	H1600L	possibly damaging	Het
Fry	A	T	5: 150,340,427	K133N	possibly damaging	Het
Gm10647	A	G	9: 66,798,330		probably benign	Het
Gm13124	T	A	4: 144,555,733	H163L	probably benign	Het
Gm16432	C	T	1: 178,046,989	P141S	unknown	Het
Gm21319	A	T	12: 87,773,513	I92N	probably damaging	Het
Gmps	T	C	3: 63,998,698	F472S	probably benign	Het
Grb10	T	C	11: 11,934,192		probably benign	Het
Grm6	G	A	11: 50,859,965	G652S	probably damaging	Het
Heca	G	T	10: 17,908,100	D468E	probably damaging	Het
Heg1	C	T	16: 33,763,615	S1033L	probably damaging	Het
Hepacam2	A	G	6: 3,487,094	S12P	probably damaging	Het
Impdh1	G	T	6: 29,206,326	H195N	probably benign	Het
Ipo7	T	C	7: 110,050,765		probably benign	Het
Itpr2	C	T	6: 146,350,022		probably null	Het
Kcnh6	G	A	11: 106,009,022	C39Y	probably benign	Het
Kif26a	T	C	12: 112,177,403	S1364P	probably damaging	Het
Lins1	T	A	7: 66,712,048		probably benign	Het
Lrpap1	C	T	5: 35,094,888	V328M	possibly damaging	Het
Lyn	T	G	4: 3,748,768	L249V	probably benign	Het
Mtmr9	A	G	14: 63,528,247	F400L	possibly damaging	Het
Mto1	G	A	9: 78,473,872	S666N	probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nsg1	T	C	5: 38,155,630	E75G	probably benign	Het
Nsun4	A	G	4: 116,035,773	M283T	probably benign	Het
Obscn	A	G	11: 59,000,062	S7215P	unknown	Het
Olfr1042	A	C	2: 86,159,574	S265R	possibly damaging	Het
Olfr1160	T	C	2: 88,005,987	I264V	probably damaging	Het
Olfr1383	G	A	11: 49,524,206	S161N	possibly damaging	Het
Olfr340	G	A	2: 36,453,095	R170K	probably benign	Het
Olfr53	T	C	7: 140,652,311	S111P	probably damaging	Het
Olfr677	T	A	7: 105,057,090	Y281*	probably null	Het
Olfr736	T	C	14: 50,392,864	I36T	probably benign	Het
Per1	T	C	11: 69,104,043	F563S	probably benign	Het
Pik3c3	T	A	18: 30,303,078		probably benign	Het
Pitrm1	A	T	13: 6,555,639	K207N	probably damaging	Het
Prdm10	C	T	9: 31,316,230	R44C	probably damaging	Het
Rab40c	A	T	17: 25,885,148	I90N	probably damaging	Het
Rbl1	A	G	2: 157,199,414		probably null	Het
Rnf17	G	A	14: 56,514,106	G1467E	probably damaging	Het
Rpgrip1	A	G	14: 52,149,384		probably benign	Het
Sall1	A	T	8: 89,030,268	N1069K	probably benign	Het
Scap	T	C	9: 110,372,222	I93T	possibly damaging	Het
Sez6	T	C	11: 77,974,344		probably benign	Het
Slc22a30	A	T	19: 8,370,197	S280T	probably benign	Het
Slc26a5	A	C	5: 21,811,344		probably null	Het
St18	T	C	1: 6,848,948	V901A	probably benign	Het
Syne2	T	C	12: 75,963,876	L2519P	probably damaging	Het
Syne4	G	A	7: 30,318,919	G362E	probably damaging	Het
Tmem51	T	C	4: 142,031,925	T171A	probably benign	Het
Tns4	A	T	11: 99,075,198	I453N	probably damaging	Het
Trank1	A	T	9: 111,392,910	H2905L	probably benign	Het
Trim13	C	T	14: 61,604,717	T61I	possibly damaging	Het
Trim75	T	C	8: 64,982,928	Q290R	possibly damaging	Het
Ttn	C	A	2: 76,729,200	R29619L	probably damaging	Het
Ugt2b38	T	A	5: 87,420,558	M293L	probably benign	Het
Vmn1r22	T	A	6: 57,900,528	N155Y	probably benign	Het
Vmn2r18	T	C	5: 151,584,804	Y285C	probably benign	Het
Vmn2r84	C	T	10: 130,386,719		probably benign	Het
Vwde	A	C	6: 13,220,005	L49R	probably damaging	Het
Yipf2	T	A	9: 21,591,966	E68D	possibly damaging	Het
Zfand5	C	A	19: 21,279,758		probably benign	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGGCAGTGAGTCGCACATTAC -3'
(R):5'- TGATTCCCTCCAAGCACTTCCAGG -3'

Sequencing Primer
(F):5'- GTGAGTCGCACATTACAATGAAC -3'
(R):5'- GTGTCCTGTAGAAGATCACTCTAGC -3'

Posted On

2013-04-11