Incidental Mutation 'R2871:Mpp7'
ID 253800
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 7347962-7626863 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7461678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 65 (P65L)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115869
AA Change: P65L

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: P65L

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7353297 missense probably benign 0.00
IGL01575:Mpp7 APN 18 7403365 splice site probably benign
IGL02973:Mpp7 APN 18 7403297 missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7461637 critical splice donor site probably null
IGL03224:Mpp7 APN 18 7403269 missense probably benign 0.28
IGL03248:Mpp7 APN 18 7403269 missense probably benign 0.28
R0040:Mpp7 UTSW 18 7403180 splice site probably benign
R0089:Mpp7 UTSW 18 7439555 splice site probably benign
R1413:Mpp7 UTSW 18 7350977 missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7350984 missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7350967 makesense probably null
R2379:Mpp7 UTSW 18 7403345 nonsense probably null
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7351085 missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7444062 missense probably benign 0.23
R4574:Mpp7 UTSW 18 7353228 missense probably benign 0.02
R4772:Mpp7 UTSW 18 7379983 splice site probably null
R5066:Mpp7 UTSW 18 7513002 missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7458930 critical splice donor site probably null
R5451:Mpp7 UTSW 18 7442855 missense probably null 0.95
R5578:Mpp7 UTSW 18 7355101 missense probably benign
R5651:Mpp7 UTSW 18 7355016 critical splice donor site probably null
R5787:Mpp7 UTSW 18 7461682 missense probably benign
R6979:Mpp7 UTSW 18 7355049 missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7441623 missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7351079 missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7440183 nonsense probably null
R8278:Mpp7 UTSW 18 7444025 missense probably benign
R8373:Mpp7 UTSW 18 7444096 missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7440430 critical splice donor site probably null
R9206:Mpp7 UTSW 18 7403327 missense probably benign 0.12
R9208:Mpp7 UTSW 18 7403327 missense probably benign 0.12
R9439:Mpp7 UTSW 18 7461692 nonsense probably null
R9790:Mpp7 UTSW 18 7355049 missense probably benign 0.07
R9791:Mpp7 UTSW 18 7355049 missense probably benign 0.07
X0028:Mpp7 UTSW 18 7403273 missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7355062 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAAGCGTGGTGATGACAG -3'
(R):5'- GTTCTGTCTGAAGAAAGTTTTGCC -3'

Sequencing Primer
(F):5'- CAGAGATTTGGGAAACATTTGCAAC -3'
(R):5'- GGATTGCATATACATGTCTGCC -3'
Posted On 2014-12-04