Mutagenetix > Incidental Mutation

Incidental Mutation 'R1786:St3gal6'

202865

Institutional Source

Beutler Lab

Gene Symbol

St3gal6

Ensembl Gene

ENSMUSG00000022747

Gene Name

ST3 beta-galactoside alpha-2,3-sialyltransferase 6

Synonyms

1700023B24Rik, ST3Gal VI, Siat10

MMRRC Submission

039817-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R1786 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58468125-58524243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58475871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 137 (D137G)

Ref Sequence

ENSEMBL: ENSMUSP00000115756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000137035]

AlphaFold

Q8VIB3

Predicted Effect

probably damaging
Transcript: ENSMUST00000114357
AA Change: D137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747
AA Change: D137G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_transf_29	63	329	6.2e-70	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114358
AA Change: D137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747
AA Change: D137G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_transf_29	71	329	7.1e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000137035
AA Change: D137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747
AA Change: D137G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_transf_29	63	329	6.2e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149197

Meta Mutation Damage Score

0.9323

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit modest impairment in leukocyte rolling and neutrophil recruitment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Abcc4	G	A	14: 118,553,349	R749C	probably damaging	Het
Acot11	T	C	4: 106,762,035	E201G	probably damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Aldh4a1	T	C	4: 139,644,128	V451A	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Asb6	G	A	2: 30,827,076	R46W	probably damaging	Het
Bpifb6	T	C	2: 153,906,861	F259S	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Camk2b	T	C	11: 5,977,880	E390G	probably benign	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc170	T	G	10: 4,519,043	I197S	probably benign	Het
Cdc20b	A	T	13: 113,081,134	K362N	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Cpd	T	C	11: 76,792,798	D1045G	probably benign	Het
Crocc	T	C	4: 141,021,802	D1564G	probably damaging	Het
Csf1r	A	T	18: 61,129,077	M802L	probably damaging	Het
Dctn4	T	C	18: 60,546,335		probably null	Het
Dnah5	A	G	15: 28,313,786	Q1916R	probably damaging	Het
Dpysl2	A	G	14: 66,862,665		probably benign	Het
Dync2h1	A	G	9: 7,081,084	Y2871H	probably damaging	Het
Fam221b	T	A	4: 43,665,537	H307L	probably damaging	Het
Foxn4	C	T	5: 114,263,132	D37N	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm9797	T	C	10: 11,609,325		noncoding transcript	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gper1	C	T	5: 139,426,722	P274L	probably damaging	Het
Gpr132	A	G	12: 112,852,403	S268P	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Hivep1	C	T	13: 42,183,786	A2447V	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Kmt2a	G	A	9: 44,819,675		probably benign	Het
Lhx6	G	T	2: 36,087,458	C327*	probably null	Het
Lifr	A	G	15: 7,181,856	D625G	possibly damaging	Het
Llgl1	T	C	11: 60,707,240	V370A	probably benign	Het
Lman1	A	T	18: 65,991,582	M362K	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lpin3	T	A	2: 160,896,809	L227*	probably null	Het
Ltv1	C	G	10: 13,182,536		probably benign	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mettl17	A	T	14: 51,888,735		probably benign	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Mov10	A	T	3: 104,818,116	I59N	possibly damaging	Het
Myo7b	T	C	18: 31,994,897	I581V	probably benign	Het
Ncdn	T	A	4: 126,745,273		probably null	Het
Ndufa4	A	T	6: 11,900,575	V37E	probably benign	Het
Nhsl1	T	G	10: 18,524,664	L546R	probably benign	Het
Nop9	T	C	14: 55,751,142	L347P	probably damaging	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Ntrk3	G	A	7: 78,477,935		probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr372	A	G	8: 72,058,436	Y252C	probably damaging	Het
Olfr968	A	T	9: 39,772,495	C102S	probably benign	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pknox2	A	G	9: 36,909,684	V294A	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Ptgdr	A	T	14: 44,858,579	Y225*	probably null	Het
Ptpn22	A	G	3: 103,874,052	I90V	probably damaging	Het
Pygb	C	T	2: 150,816,772	T372I	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Qrich2	C	T	11: 116,441,449	G2307D	probably damaging	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Slfn9	T	A	11: 82,981,307	I868F	probably damaging	Het
Synj1	G	T	16: 90,964,517	A687D	probably damaging	Het
Syt4	A	G	18: 31,443,443		probably benign	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tmem200a	T	A	10: 25,993,927	H148L	probably damaging	Het
Trappc8	A	G	18: 20,834,940		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ubr4	T	A	4: 139,423,945	M1897K	probably damaging	Het
Uggt2	A	G	14: 119,061,376	L391P	probably damaging	Het
Uncx	T	C	5: 139,547,547	S456P	probably benign	Het
Vps13b	A	G	15: 35,879,791	Y3004C	probably damaging	Het
Wisp1	G	A	15: 66,906,489	C53Y	probably damaging	Het
Zbtb46	C	T	2: 181,391,431	C479Y	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp503	A	T	14: 21,985,520	C443S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in St3gal6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01518:St3gal6	APN	16	58484775	missense	probably benign	0.31
IGL01583:St3gal6	APN	16	58493670	unclassified	probably benign
IGL02512:St3gal6	APN	16	58473459	missense	probably benign	0.00
R0212:St3gal6	UTSW	16	58473453	missense	probably damaging	0.96
R0212:St3gal6	UTSW	16	58473455	missense	probably damaging	1.00
R0441:St3gal6	UTSW	16	58473453	missense	probably damaging	0.96
R0441:St3gal6	UTSW	16	58473455	missense	probably damaging	1.00
R0442:St3gal6	UTSW	16	58473453	missense	probably damaging	0.96
R0442:St3gal6	UTSW	16	58473455	missense	probably damaging	1.00
R1939:St3gal6	UTSW	16	58473561	splice site	probably null
R2233:St3gal6	UTSW	16	58473534	missense	probably damaging	1.00
R2274:St3gal6	UTSW	16	58488969	missense	possibly damaging	0.46
R2336:St3gal6	UTSW	16	58493704	missense	probably damaging	1.00
R2434:St3gal6	UTSW	16	58470652	missense	probably damaging	1.00
R3789:St3gal6	UTSW	16	58484773	missense	probably benign	0.07
R6318:St3gal6	UTSW	16	58486406	missense	probably benign	0.01
R7320:St3gal6	UTSW	16	58493711	missense	probably benign	0.00
R7599:St3gal6	UTSW	16	58473437	missense	probably benign	0.00
R8907:St3gal6	UTSW	16	58493732	missense	probably benign	0.00
R9100:St3gal6	UTSW	16	58486430	missense
R9593:St3gal6	UTSW	16	58484773	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTAGTTTACTATAGCCAGTAACC -3'
(R):5'- CTTGAATCTCTGGACCTCAGGC -3'

Sequencing Primer
(F):5'- GTTTACTATAGCCAGTAACCAAGGC -3'
(R):5'- ACCTCAGGCACAGTTGGTTC -3'

Posted On

2014-06-23