Incidental Mutation 'R0129:Fam184b'
ID21558
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Namefamily with sequence similarity 184, member B
Synonyms9630031F12Rik
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0129 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location45529705-45639614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45532778 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 830 (S830P)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023] [ENSMUST00000156481]
Predicted Effect probably damaging
Transcript: ENSMUST00000016023
AA Change: S830P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: S830P

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156481
SMART Domains Protein: ENSMUSP00000115882
Gene: ENSMUSG00000015804

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Med28 72 136 4.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199190
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1215:Fam184b UTSW 5 45584178 missense probably damaging 1.00
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6060:Fam184b UTSW 5 45553147 missense probably damaging 0.99
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7429:Fam184b UTSW 5 45540888 missense probably benign
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCTGGGTTTTCCCAGCGACTG -3'
(R):5'- TTGCTAAGGCACTGTGCCCTTC -3'

Sequencing Primer
(F):5'- AGCGACTGTCCCACCAG -3'
(R):5'- TGCTCGGATGCCACTCAC -3'
Posted On2013-04-11