Mutagenetix > Incidental Mutation

Incidental Mutation 'R1959:Fsip2'

218106

Institutional Source

Beutler Lab

Gene Symbol

Fsip2

Ensembl Gene

ENSMUSG00000075249

Gene Name

fibrous sheath-interacting protein 2

Synonyms

OTTMUSG00000013335

MMRRC Submission

039973-MU

Accession Numbers

Genbank: XM_913669; MGI: 2664111

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R1959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82943634-83008937 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82991550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 5876 (K5876E)

Ref Sequence

ENSEMBL: ENSMUSP00000120314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000143764]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000132967

SMART Domains

Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

Domain	Start	End	E-Value	Type
low complexity region	22	38	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	381	392	N/A	INTRINSIC
low complexity region	411	430	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
low complexity region	953	962	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143764
AA Change: K5876E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: K5876E

Domain	Start	End	E-Value	Type
coiled coil region	271	297	N/A	INTRINSIC
low complexity region	544	561	N/A	INTRINSIC
low complexity region	586	597	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
low complexity region	925	939	N/A	INTRINSIC
low complexity region	1115	1120	N/A	INTRINSIC
low complexity region	1531	1545	N/A	INTRINSIC
low complexity region	2044	2057	N/A	INTRINSIC
low complexity region	2507	2523	N/A	INTRINSIC
low complexity region	2564	2575	N/A	INTRINSIC
low complexity region	2866	2877	N/A	INTRINSIC
low complexity region	2896	2915	N/A	INTRINSIC
low complexity region	3220	3231	N/A	INTRINSIC
low complexity region	3438	3447	N/A	INTRINSIC
Pfam:FSIP2	4045	4408	3.5e-42	PFAM
Pfam:FSIP2	4375	4613	7.7e-26	PFAM
Pfam:FSIP2	4622	4932	4.3e-17	PFAM
Pfam:FSIP2	4903	5454	7e-27	PFAM
low complexity region	5507	5522	N/A	INTRINSIC
low complexity region	5769	5780	N/A	INTRINSIC
low complexity region	5834	5846	N/A	INTRINSIC
low complexity region	5851	5867	N/A	INTRINSIC
Pfam:FSIP2	5998	6867	N/A	PFAM
low complexity region	6977	6990	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Aco1	T	C	4: 40,167,193		probably null	Het
Adap1	A	G	5: 139,273,341	Y364H	probably benign	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgb	A	T	10: 10,395,249	D883E	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Anapc1	C	A	2: 128,633,415	R1381S	probably benign	Het
Aoah	A	G	13: 20,794,394	M1V	probably null	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arhgap10	A	G	8: 77,409,626	F319S	possibly damaging	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cabin1	A	T	10: 75,735,090	V784E	possibly damaging	Het
Card9	T	A	2: 26,354,873		probably null	Het
Cdk18	A	G	1: 132,117,821	I238T	possibly damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Commd3	A	T	2: 18,673,963	I70F	probably benign	Het
Cspg5	G	A	9: 110,251,026	V340M	probably damaging	Het
Cyb5r4	G	A	9: 87,055,849	S307N	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Ddx11	A	G	17: 66,130,728	M150V	probably benign	Het
Dennd4b	A	G	3: 90,268,773	Y190C	probably damaging	Het
Det1	A	G	7: 78,843,443	V271A	probably benign	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dhx36	T	C	3: 62,479,385	S649G	probably benign	Het
Dlgap5	A	G	14: 47,416,386	I62T	possibly damaging	Het
Dmgdh	A	G	13: 93,720,559	M724V	probably benign	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dock4	A	T	12: 40,710,798	K495M	probably damaging	Het
Dse	A	G	10: 34,160,206	Y225H	probably damaging	Het
Emx1	G	A	6: 85,203,934	R211K	probably damaging	Het
Ergic2	A	G	6: 148,199,354		probably null	Het
Fbxo27	G	A	7: 28,698,372	C277Y	possibly damaging	Het
Fcrl1	T	C	3: 87,376,520	I9T	possibly damaging	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Flnb	C	T	14: 7,884,735	Q445*	probably null	Het
Flrt2	G	A	12: 95,780,300	V471I	probably benign	Het
Frmd4a	G	A	2: 4,535,186	V210M	probably damaging	Het
Galnt10	T	C	11: 57,765,617	L209P	probably damaging	Het
Gata5	A	T	2: 180,326,936	S382T	possibly damaging	Het
Glt6d1	C	A	2: 25,794,413	V194L	probably damaging	Het
Gm10803	T	G	2: 93,563,943	V20G	unknown	Het
Gm44511	T	G	6: 128,820,271	T52P	probably damaging	Het
Gpat4	A	T	8: 23,182,936	L88Q	possibly damaging	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Hivep2	A	T	10: 14,132,709	I1684F	probably benign	Het
Hmcn1	T	C	1: 150,649,676	T3366A	probably benign	Het
Hnmt	A	G	2: 24,003,882	V200A	possibly damaging	Het
Hps6	A	T	19: 46,004,335	H237L	probably benign	Het
Hspg2	C	T	4: 137,564,895	P4033S	probably damaging	Het
Irf9	T	A	14: 55,607,717	S297T	possibly damaging	Het
Kdm3b	T	C	18: 34,812,395	V753A	possibly damaging	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Krtap4-16	A	G	11: 99,851,547	V9A	unknown	Het
Lama2	G	T	10: 27,422,618	P161T	probably damaging	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Lvrn	T	A	18: 46,894,717	S866R	probably damaging	Het
Med13	A	G	11: 86,298,979	Y1035H	probably damaging	Het
Mertk	T	A	2: 128,759,090	N331K	probably damaging	Het
Mios	T	A	6: 8,215,437	F211Y	probably benign	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mphosph9	A	T	5: 124,315,701	S183T	possibly damaging	Het
Mrto4	A	T	4: 139,349,638	I56N	probably damaging	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Ncoa2	A	G	1: 13,160,252	Y1023H	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Nr2f1	T	C	13: 78,189,816	T237A	probably damaging	Het
Nup205	C	A	6: 35,233,366	Q1621K	probably benign	Het
Nxpe2	T	A	9: 48,319,726	S448C	probably benign	Het
Ogdh	T	A	11: 6,346,638	C498S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr281	T	C	15: 98,456,753	S148P	probably damaging	Het
Olfr294	A	T	7: 86,616,431	F71L	probably benign	Het
Olfr414	A	T	1: 174,430,905	K159M	probably damaging	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr715	A	T	7: 107,128,510	D294E	possibly damaging	Het
Olfr994	T	C	2: 85,430,619	D70G	probably damaging	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pcdhb9	T	A	18: 37,403,316	Y788N	probably damaging	Het
Pcsk5	T	C	19: 17,433,418	D1870G	unknown	Het
Pde6g	A	G	11: 120,448,136	L76P	probably damaging	Het
Peak1	A	T	9: 56,206,789	Y593N	probably damaging	Het
Pfas	C	T	11: 68,994,284	G16R	probably damaging	Het
Pkd1l2	A	T	8: 117,043,231		probably null	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Ptpru	T	A	4: 131,803,477	I489F	probably damaging	Het
Rere	T	G	4: 150,468,790	H146Q	probably benign	Het
Rundc1	A	T	11: 101,431,496	Q272L	probably damaging	Het
Scml4	T	C	10: 42,956,021	L305P	probably damaging	Het
Sec16a	A	T	2: 26,430,132	H1431Q	probably benign	Het
Serpina1a	G	A	12: 103,853,800	Q373*	probably null	Het
Shank1	A	T	7: 44,325,377	N377I	unknown	Het
Shc2	T	C	10: 79,626,791		probably null	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc7a2	A	T	8: 40,914,965	I589F	probably damaging	Het
Smim8	C	T	4: 34,771,316	R26Q	probably damaging	Het
Smox	C	A	2: 131,520,464	A221D	probably damaging	Het
Sox5	A	G	6: 143,874,105	S62P	possibly damaging	Het
Spg21	A	C	9: 65,484,492	K240N	probably damaging	Het
Sv2c	C	T	13: 95,976,645	V599M	probably damaging	Het
Tanc2	T	A	11: 105,910,295	H1112Q	probably damaging	Het
Tbata	T	C	10: 61,175,844	I58T	possibly damaging	Het
Tbc1d2	T	G	4: 46,606,419	Y842S	probably benign	Het
Tctn1	A	T	5: 122,241,840		probably null	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Tfcp2l1	T	C	1: 118,669,389	V400A	probably benign	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Top2a	T	C	11: 98,995,977		probably null	Het
Traf7	C	A	17: 24,513,281	G191C	probably damaging	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttc30b	C	T	2: 75,937,099	E437K	probably benign	Het
Ttn	T	C	2: 76,750,623	I23309V	probably benign	Het
Usp50	T	C	2: 126,777,961	K199E	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,513	F10S	probably damaging	Het
Vmn2r89	C	A	14: 51,457,440	T459K	probably benign	Het
Vps13a	T	G	19: 16,677,938	S1909R	possibly damaging	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Vwa8	A	G	14: 78,982,360	H516R	possibly damaging	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het
Zfat	G	C	15: 68,146,543	P974R	probably benign	Het
Zfc3h1	T	A	10: 115,423,253	I1601K	probably benign	Het
Zfp239	A	G	6: 117,871,817	K172R	probably benign	Het
Zfp335	C	T	2: 164,894,802	G971D	probably damaging	Het
Zfp532	A	T	18: 65,624,492	I499F	probably damaging	Het
Zfp647	T	C	15: 76,911,114	T449A	possibly damaging	Het
Zfp938	C	T	10: 82,225,631	G385D	probably damaging	Het
Zfp959	T	G	17: 55,897,404	V147G	probably damaging	Het
Znfx1	A	T	2: 167,050,350	C649S	probably damaging	Het

Other mutations in Fsip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Fsip2	APN	2	82990386	missense	probably benign	0.18
IGL00557:Fsip2	APN	2	82991313	missense	possibly damaging	0.53
IGL01343:Fsip2	APN	2	82999819	missense	possibly damaging	0.53
IGL01387:Fsip2	APN	2	82992982	missense	possibly damaging	0.71
IGL01523:Fsip2	APN	2	82977519	missense	probably benign
IGL01554:Fsip2	APN	2	82977278	missense	possibly damaging	0.68
IGL01650:Fsip2	APN	2	82991086	missense	probably benign	0.33
IGL01809:Fsip2	APN	2	82978347	missense	possibly damaging	0.80
IGL01826:Fsip2	APN	2	82982639	missense	probably benign	0.18
IGL01830:Fsip2	APN	2	82984929	missense	probably benign
IGL01918:Fsip2	APN	2	82992138	missense	possibly damaging	0.71
IGL01932:Fsip2	APN	2	82994005	missense	possibly damaging	0.71
IGL01989:Fsip2	APN	2	82993867	missense	probably damaging	0.99
IGL02096:Fsip2	APN	2	82991860	missense	possibly damaging	0.85
IGL02153:Fsip2	APN	2	82978721	missense	probably benign
IGL02155:Fsip2	APN	2	82998352	missense	probably benign
IGL02219:Fsip2	APN	2	82977830	missense	probably benign	0.07
IGL02248:Fsip2	APN	2	82982772	missense	possibly damaging	0.73
IGL02316:Fsip2	APN	2	82978793	missense	probably benign
IGL02478:Fsip2	APN	2	82984392	missense	probably benign	0.00
IGL02504:Fsip2	APN	2	82978855	missense	possibly damaging	0.83
IGL02572:Fsip2	APN	2	82992003	missense	probably benign	0.32
IGL02625:Fsip2	APN	2	82949492	missense	probably benign	0.00
IGL02665:Fsip2	APN	2	82993063	missense	probably damaging	1.00
IGL02668:Fsip2	APN	2	82998318	missense	probably benign	0.06
IGL02676:Fsip2	APN	2	82982157	missense	possibly damaging	0.53
IGL02717:Fsip2	APN	2	82951026	splice site	probably benign
IGL02805:Fsip2	APN	2	82993495	missense	probably benign	0.01
IGL02943:Fsip2	APN	2	82992357	missense	probably benign	0.32
IGL02965:Fsip2	APN	2	82983054	missense	probably benign	0.33
IGL03001:Fsip2	APN	2	82990624	intron	probably benign
IGL03076:Fsip2	APN	2	82982138	missense	possibly damaging	0.96
IGL03229:Fsip2	APN	2	82978076	missense	possibly damaging	0.86
IGL03353:Fsip2	APN	2	82977393	missense	possibly damaging	0.85
IGL03401:Fsip2	APN	2	82990470	missense	probably benign
bubblegum	UTSW	2	82992840	missense	probably benign	0.16
Dao	UTSW	2	82993150	missense	probably damaging	0.97
engulf	UTSW	2	82984776	missense	probably damaging	0.98
envelope	UTSW	2	82980741	missense	probably benign	0.07
gladius	UTSW	2	82981949	missense	possibly damaging	0.68
glove	UTSW	2	82978394	missense	possibly damaging	0.85
Katana	UTSW	2	82989516	missense	probably benign	0.07
scarf	UTSW	2	82986891	missense	probably benign
Sock	UTSW	2	82998180	missense	probably benign	0.00
swaddle	UTSW	2	82983428	missense	possibly damaging	0.93
wrap	UTSW	2	82986820	missense	probably benign	0.04
Wrapper	UTSW	2	82990086	missense	possibly damaging	0.71
D4186:Fsip2	UTSW	2	82988412	missense	probably benign	0.32
FR4976:Fsip2	UTSW	2	82984362	critical splice acceptor site	probably benign
FR4976:Fsip2	UTSW	2	82984365	critical splice acceptor site	probably benign
PIT4382001:Fsip2	UTSW	2	82990852	missense	possibly damaging	0.86
R0017:Fsip2	UTSW	2	82992072	missense	probably damaging	0.98
R0017:Fsip2	UTSW	2	82992072	missense	probably damaging	0.98
R0021:Fsip2	UTSW	2	82999857	splice site	probably benign
R0054:Fsip2	UTSW	2	82976608	missense	probably damaging	0.96
R0054:Fsip2	UTSW	2	82986955	missense	possibly damaging	0.85
R0054:Fsip2	UTSW	2	82986955	missense	possibly damaging	0.85
R0104:Fsip2	UTSW	2	82978973	missense	possibly damaging	0.91
R0104:Fsip2	UTSW	2	82978973	missense	possibly damaging	0.91
R0127:Fsip2	UTSW	2	82984925	missense	probably benign	0.28
R0131:Fsip2	UTSW	2	82991121	missense	probably benign
R0149:Fsip2	UTSW	2	82975505	missense	possibly damaging	0.93
R0167:Fsip2	UTSW	2	82980807	missense	possibly damaging	0.53
R0190:Fsip2	UTSW	2	82985177	missense	possibly damaging	0.73
R0323:Fsip2	UTSW	2	82985896	missense	probably benign	0.33
R0358:Fsip2	UTSW	2	82983333	missense	possibly damaging	0.56
R0361:Fsip2	UTSW	2	82975505	missense	possibly damaging	0.93
R0369:Fsip2	UTSW	2	82984564	missense	probably benign	0.33
R0394:Fsip2	UTSW	2	82991075	missense	possibly damaging	0.70
R0532:Fsip2	UTSW	2	82977785	missense	probably benign	0.33
R0595:Fsip2	UTSW	2	82946952	missense	probably damaging	0.99
R0613:Fsip2	UTSW	2	82993795	missense	probably damaging	0.99
R0614:Fsip2	UTSW	2	82977533	missense	probably benign	0.15
R0619:Fsip2	UTSW	2	82944140	missense	probably damaging	1.00
R0626:Fsip2	UTSW	2	82988958	missense	probably benign	0.06
R0644:Fsip2	UTSW	2	82976897	missense	probably benign	0.02
R0661:Fsip2	UTSW	2	82986169	missense	possibly damaging	0.92
R0680:Fsip2	UTSW	2	82991359	missense	possibly damaging	0.73
R0688:Fsip2	UTSW	2	82982339	missense	probably benign	0.18
R0881:Fsip2	UTSW	2	82986273	missense	possibly damaging	0.52
R0919:Fsip2	UTSW	2	82985484	missense	possibly damaging	0.53
R0973:Fsip2	UTSW	2	82977092	missense	probably benign	0.05
R0973:Fsip2	UTSW	2	82977092	missense	probably benign	0.05
R0974:Fsip2	UTSW	2	82977092	missense	probably benign	0.05
R0976:Fsip2	UTSW	2	82998031	missense	possibly damaging	0.92
R1025:Fsip2	UTSW	2	82989436	nonsense	probably null
R1026:Fsip2	UTSW	2	82988461	missense	possibly damaging	0.52
R1140:Fsip2	UTSW	2	82975034	missense	probably damaging	0.99
R1170:Fsip2	UTSW	2	82991500	missense	possibly damaging	0.72
R1180:Fsip2	UTSW	2	82975226	missense	probably damaging	0.99
R1188:Fsip2	UTSW	2	82975017	missense	possibly damaging	0.96
R1226:Fsip2	UTSW	2	82981011	missense	probably damaging	0.96
R1248:Fsip2	UTSW	2	82989763	missense	possibly damaging	0.93
R1273:Fsip2	UTSW	2	82989408	missense	possibly damaging	0.92
R1323:Fsip2	UTSW	2	82985752	missense	probably damaging	1.00
R1323:Fsip2	UTSW	2	82985752	missense	probably damaging	1.00
R1356:Fsip2	UTSW	2	82989745	missense	probably benign	0.38
R1413:Fsip2	UTSW	2	82988418	missense	possibly damaging	0.93
R1430:Fsip2	UTSW	2	82998063	missense	possibly damaging	0.71
R1475:Fsip2	UTSW	2	82987195	missense	probably damaging	0.99
R1489:Fsip2	UTSW	2	82979811	missense	probably benign
R1520:Fsip2	UTSW	2	82980714	missense	possibly damaging	0.96
R1543:Fsip2	UTSW	2	82981587	missense	possibly damaging	0.91
R1581:Fsip2	UTSW	2	82986282	missense	probably damaging	0.98
R1590:Fsip2	UTSW	2	82982787	missense	probably benign	0.26
R1646:Fsip2	UTSW	2	82978517	missense	probably benign	0.07
R1678:Fsip2	UTSW	2	82986345	missense	probably benign
R1700:Fsip2	UTSW	2	82991737	missense	probably benign	0.33
R1717:Fsip2	UTSW	2	82974945	missense	possibly damaging	0.68
R1741:Fsip2	UTSW	2	82989912	missense	probably benign	0.32
R1760:Fsip2	UTSW	2	82984896	missense	probably benign	0.07
R1760:Fsip2	UTSW	2	82987711	missense	possibly damaging	0.71
R1760:Fsip2	UTSW	2	82999841	missense	possibly damaging	0.85
R1789:Fsip2	UTSW	2	82977562	missense	probably benign	0.00
R1850:Fsip2	UTSW	2	82984589	missense	possibly damaging	0.72
R1854:Fsip2	UTSW	2	82993257	missense	possibly damaging	0.84
R1888:Fsip2	UTSW	2	82944160	missense	probably benign	0.04
R1888:Fsip2	UTSW	2	82944160	missense	probably benign	0.04
R1905:Fsip2	UTSW	2	82983428	missense	possibly damaging	0.93
R1907:Fsip2	UTSW	2	82983428	missense	possibly damaging	0.93
R1920:Fsip2	UTSW	2	82986820	missense	probably benign	0.04
R1921:Fsip2	UTSW	2	82980783	nonsense	probably null
R1921:Fsip2	UTSW	2	82986820	missense	probably benign	0.04
R1931:Fsip2	UTSW	2	82986733	missense	probably damaging	0.99
R1934:Fsip2	UTSW	2	82980558	missense	possibly damaging	0.91
R1965:Fsip2	UTSW	2	82992780	missense	possibly damaging	0.86
R1966:Fsip2	UTSW	2	82992780	missense	possibly damaging	0.86
R1983:Fsip2	UTSW	2	82979831	missense	probably benign
R1988:Fsip2	UTSW	2	82976517	missense	possibly damaging	0.56
R2016:Fsip2	UTSW	2	82982732	missense	possibly damaging	0.53
R2017:Fsip2	UTSW	2	82982732	missense	possibly damaging	0.53
R2026:Fsip2	UTSW	2	82989444	missense	possibly damaging	0.71
R2034:Fsip2	UTSW	2	82989494	missense	probably benign	0.43
R2037:Fsip2	UTSW	2	82978512	missense	probably damaging	0.99
R2070:Fsip2	UTSW	2	82976355	missense	probably damaging	0.98
R2072:Fsip2	UTSW	2	83008815	missense	possibly damaging	0.53
R2075:Fsip2	UTSW	2	82988579	missense	possibly damaging	0.85
R2143:Fsip2	UTSW	2	82990271	missense	possibly damaging	0.93
R2207:Fsip2	UTSW	2	82977479	missense	probably benign	0.02
R2256:Fsip2	UTSW	2	82962751	missense	probably benign	0.07
R2315:Fsip2	UTSW	2	82975093	missense	probably benign
R2344:Fsip2	UTSW	2	82989913	missense	possibly damaging	0.71
R2377:Fsip2	UTSW	2	82976249	missense	probably benign	0.29
R2403:Fsip2	UTSW	2	82980720	missense	possibly damaging	0.53
R2441:Fsip2	UTSW	2	82985341	missense	possibly damaging	0.53
R2504:Fsip2	UTSW	2	82979610	missense	possibly damaging	0.86
R2510:Fsip2	UTSW	2	82986438	missense	probably benign
R2511:Fsip2	UTSW	2	82951657	missense	probably damaging	1.00
R2511:Fsip2	UTSW	2	82986438	missense	probably benign
R2512:Fsip2	UTSW	2	82978167	missense	probably benign	0.04
R2568:Fsip2	UTSW	2	82990431	missense	probably benign	0.14
R2656:Fsip2	UTSW	2	82979045	missense	possibly damaging	0.83
R2883:Fsip2	UTSW	2	82991524	missense	possibly damaging	0.86
R3417:Fsip2	UTSW	2	82986510	missense	possibly damaging	0.51
R3431:Fsip2	UTSW	2	82992010	missense	possibly damaging	0.85
R3441:Fsip2	UTSW	2	82986727	missense	probably benign	0.00
R3605:Fsip2	UTSW	2	82984909	missense	probably benign	0.28
R3620:Fsip2	UTSW	2	82980258	missense	probably benign	0.00
R3621:Fsip2	UTSW	2	82980258	missense	probably benign	0.00
R3726:Fsip2	UTSW	2	82988967	missense	possibly damaging	0.84
R3755:Fsip2	UTSW	2	82978217	missense	probably benign	0.26
R3789:Fsip2	UTSW	2	82982714	missense	probably damaging	0.96
R3836:Fsip2	UTSW	2	82950946	missense	probably damaging	1.00
R3844:Fsip2	UTSW	2	82989606	missense	possibly damaging	0.52
R3846:Fsip2	UTSW	2	82986415	missense	possibly damaging	0.52
R3861:Fsip2	UTSW	2	82984776	missense	probably damaging	0.98
R3981:Fsip2	UTSW	2	82958662	missense	probably benign	0.08
R4014:Fsip2	UTSW	2	82983518	missense	probably benign
R4042:Fsip2	UTSW	2	82983552	missense	probably benign	0.02
R4075:Fsip2	UTSW	2	82982901	missense	probably benign	0.26
R4154:Fsip2	UTSW	2	82987069	missense	possibly damaging	0.71
R4210:Fsip2	UTSW	2	82975149	missense	probably damaging	0.99
R4211:Fsip2	UTSW	2	82975149	missense	probably damaging	0.99
R4327:Fsip2	UTSW	2	82987059	missense	probably benign	0.25
R4332:Fsip2	UTSW	2	82977857	missense	probably benign	0.00
R4440:Fsip2	UTSW	2	82991206	missense	possibly damaging	0.85
R4454:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4455:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4457:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4458:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4540:Fsip2	UTSW	2	82951665	missense	probably benign
R4549:Fsip2	UTSW	2	82989628	missense	probably damaging	0.99
R4558:Fsip2	UTSW	2	82984953	missense	possibly damaging	0.73
R4573:Fsip2	UTSW	2	82986166	missense	possibly damaging	0.71
R4583:Fsip2	UTSW	2	82978673	missense	probably benign	0.33
R4618:Fsip2	UTSW	2	82987759	missense	probably benign
R4700:Fsip2	UTSW	2	82987029	missense	probably benign	0.32
R4716:Fsip2	UTSW	2	82974859	missense	probably damaging	0.96
R4739:Fsip2	UTSW	2	82975353	missense	possibly damaging	0.92
R4749:Fsip2	UTSW	2	82989285	missense	probably benign	0.06
R4791:Fsip2	UTSW	2	82982108	missense	possibly damaging	0.53
R4793:Fsip2	UTSW	2	82987700	nonsense	probably null
R4819:Fsip2	UTSW	2	82988442	missense	probably benign	0.06
R4832:Fsip2	UTSW	2	82990171	missense	possibly damaging	0.92
R4840:Fsip2	UTSW	2	82949395	missense	probably benign	0.01
R4840:Fsip2	UTSW	2	82985471	missense	probably benign	0.26
R4865:Fsip2	UTSW	2	82990951	missense	possibly damaging	0.86
R4876:Fsip2	UTSW	2	82974858	missense	possibly damaging	0.91
R4885:Fsip2	UTSW	2	82988094	missense	probably benign	0.02
R4911:Fsip2	UTSW	2	82981493	missense	possibly damaging	0.85
R4918:Fsip2	UTSW	2	82993770	missense	possibly damaging	0.51
R4936:Fsip2	UTSW	2	82985040	missense	probably benign	0.18
R4950:Fsip2	UTSW	2	82946932	missense	probably damaging	0.97
R4950:Fsip2	UTSW	2	82977414	missense	probably benign	0.03
R4959:Fsip2	UTSW	2	82984825	missense	probably benign	0.00
R4971:Fsip2	UTSW	2	82985878	missense	probably benign	0.38
R4973:Fsip2	UTSW	2	82984825	missense	probably benign	0.00
R4976:Fsip2	UTSW	2	82988191	missense	probably damaging	0.99
R5022:Fsip2	UTSW	2	82979429	missense	probably benign	0.33
R5027:Fsip2	UTSW	2	82989133	missense	possibly damaging	0.71
R5030:Fsip2	UTSW	2	82988492	missense	possibly damaging	0.85
R5048:Fsip2	UTSW	2	82993150	missense	probably damaging	0.97
R5096:Fsip2	UTSW	2	82991116	missense	probably benign	0.00
R5097:Fsip2	UTSW	2	82991985	missense	probably benign
R5119:Fsip2	UTSW	2	82988191	missense	probably damaging	0.99
R5138:Fsip2	UTSW	2	82981424	missense	probably benign	0.12
R5152:Fsip2	UTSW	2	82978572	missense	probably benign	0.43
R5174:Fsip2	UTSW	2	82980741	missense	probably benign	0.07
R5193:Fsip2	UTSW	2	82982994	missense	possibly damaging	0.53
R5245:Fsip2	UTSW	2	82993161	missense	probably benign	0.02
R5282:Fsip2	UTSW	2	82978581	missense	possibly damaging	0.61
R5323:Fsip2	UTSW	2	82988145	missense	possibly damaging	0.71
R5326:Fsip2	UTSW	2	82981863	missense	possibly damaging	0.84
R5378:Fsip2	UTSW	2	82989841	missense	possibly damaging	0.71
R5380:Fsip2	UTSW	2	82975398	missense	possibly damaging	0.91
R5396:Fsip2	UTSW	2	82990918	missense	probably benign	0.00
R5422:Fsip2	UTSW	2	82982228	missense	probably benign	0.00
R5481:Fsip2	UTSW	2	82979886	missense	probably benign	0.26
R5482:Fsip2	UTSW	2	82985310	missense	possibly damaging	0.80
R5513:Fsip2	UTSW	2	82950908	missense	probably damaging	1.00
R5513:Fsip2	UTSW	2	82950912	missense	probably benign	0.07
R5513:Fsip2	UTSW	2	82985198	missense	possibly damaging	0.72
R5536:Fsip2	UTSW	2	82987059	missense	probably benign	0.25
R5542:Fsip2	UTSW	2	82981863	missense	possibly damaging	0.84
R5553:Fsip2	UTSW	2	82962746	missense	probably benign
R5568:Fsip2	UTSW	2	82986564	missense	probably benign	0.25
R5581:Fsip2	UTSW	2	82998128	missense	possibly damaging	0.84
R5664:Fsip2	UTSW	2	82988095	missense	probably benign	0.05
R5672:Fsip2	UTSW	2	82987494	nonsense	probably null
R5712:Fsip2	UTSW	2	83008848	missense	possibly damaging	0.73
R5762:Fsip2	UTSW	2	82977916	missense	probably benign	0.33
R5772:Fsip2	UTSW	2	82984740	missense	probably benign
R5881:Fsip2	UTSW	2	82984441	missense	possibly damaging	0.72
R5919:Fsip2	UTSW	2	82992609	missense	possibly damaging	0.71
R5920:Fsip2	UTSW	2	82988508	nonsense	probably null
R5934:Fsip2	UTSW	2	82986748	missense	possibly damaging	0.86
R5938:Fsip2	UTSW	2	82977491	missense	probably benign	0.00
R5974:Fsip2	UTSW	2	82963313	missense	possibly damaging	0.68
R5991:Fsip2	UTSW	2	82990468	missense	probably benign	0.28
R6019:Fsip2	UTSW	2	82987939	missense	possibly damaging	0.52
R6020:Fsip2	UTSW	2	82992127	missense	probably damaging	0.99
R6056:Fsip2	UTSW	2	82985673	missense	probably benign	0.01
R6057:Fsip2	UTSW	2	82979433	missense	probably damaging	0.99
R6139:Fsip2	UTSW	2	82991044	missense	possibly damaging	0.85
R6145:Fsip2	UTSW	2	82993768	missense	possibly damaging	0.71
R6160:Fsip2	UTSW	2	82987945	nonsense	probably null
R6161:Fsip2	UTSW	2	82987257	missense	possibly damaging	0.80
R6166:Fsip2	UTSW	2	82980727	missense	probably benign	0.00
R6187:Fsip2	UTSW	2	82982454	missense	probably benign	0.33
R6196:Fsip2	UTSW	2	82989883	missense	possibly damaging	0.71
R6217:Fsip2	UTSW	2	82988418	missense	possibly damaging	0.93
R6276:Fsip2	UTSW	2	82980441	missense	possibly damaging	0.91
R6278:Fsip2	UTSW	2	82988898	missense	probably benign	0.16
R6349:Fsip2	UTSW	2	82993072	missense	probably benign	0.05
R6351:Fsip2	UTSW	2	82992684	missense	possibly damaging	0.51
R6401:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6404:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6405:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6437:Fsip2	UTSW	2	82983492	missense	possibly damaging	0.73
R6478:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6479:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6480:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6481:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6521:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6529:Fsip2	UTSW	2	82982313	missense	probably benign
R6621:Fsip2	UTSW	2	82989814	missense	possibly damaging	0.93
R6639:Fsip2	UTSW	2	82983227	missense	possibly damaging	0.85
R6649:Fsip2	UTSW	2	82967817	missense	possibly damaging	0.83
R6714:Fsip2	UTSW	2	82979534	missense	probably benign	0.01
R6714:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6749:Fsip2	UTSW	2	82978394	missense	possibly damaging	0.85
R6765:Fsip2	UTSW	2	82986432	missense	probably benign
R6790:Fsip2	UTSW	2	82990939	missense	possibly damaging	0.53
R6793:Fsip2	UTSW	2	82989494	missense	probably benign	0.43
R6795:Fsip2	UTSW	2	82980959	missense	probably benign	0.08
R6818:Fsip2	UTSW	2	82985200	missense	probably benign	0.04
R6844:Fsip2	UTSW	2	82983625	missense	possibly damaging	0.72
R6848:Fsip2	UTSW	2	82982787	missense	probably benign	0.26
R6945:Fsip2	UTSW	2	82992840	missense	probably benign	0.16
R6950:Fsip2	UTSW	2	82985988	missense	probably benign	0.03
R6951:Fsip2	UTSW	2	82981949	missense	possibly damaging	0.68
R6974:Fsip2	UTSW	2	82978717	missense	probably damaging	0.96
R6987:Fsip2	UTSW	2	82948286	nonsense	probably null
R6989:Fsip2	UTSW	2	82976954	missense	probably benign	0.00
R7001:Fsip2	UTSW	2	82986925	missense	probably damaging	1.00
R7002:Fsip2	UTSW	2	82989343	missense	possibly damaging	0.86
R7016:Fsip2	UTSW	2	82990635	missense	probably benign	0.25
R7066:Fsip2	UTSW	2	82990891	missense	possibly damaging	0.86
R7067:Fsip2	UTSW	2	82980734	missense	possibly damaging	0.85
R7077:Fsip2	UTSW	2	82983152	missense	probably benign	0.18
R7099:Fsip2	UTSW	2	82987624	missense	probably benign
R7126:Fsip2	UTSW	2	82983141	missense	possibly damaging	0.53
R7156:Fsip2	UTSW	2	82982741	missense	probably benign	0.00
R7165:Fsip2	UTSW	2	82981197	missense	possibly damaging	0.77
R7171:Fsip2	UTSW	2	82986227	nonsense	probably null
R7189:Fsip2	UTSW	2	82993237	missense	possibly damaging	0.92
R7217:Fsip2	UTSW	2	82989068	missense	possibly damaging	0.85
R7222:Fsip2	UTSW	2	82983671	missense	probably benign
R7228:Fsip2	UTSW	2	82992307	missense	possibly damaging	0.93
R7238:Fsip2	UTSW	2	82982140	missense	possibly damaging	0.72
R7244:Fsip2	UTSW	2	82993263	missense	possibly damaging	0.92
R7251:Fsip2	UTSW	2	82979081	missense	possibly damaging	0.95
R7259:Fsip2	UTSW	2	82982130	missense	possibly damaging	0.85
R7291:Fsip2	UTSW	2	82980519	missense	possibly damaging	0.91
R7316:Fsip2	UTSW	2	82989691	missense	possibly damaging	0.93
R7323:Fsip2	UTSW	2	82989516	missense	probably benign	0.07
R7335:Fsip2	UTSW	2	82983118	missense	probably benign
R7343:Fsip2	UTSW	2	82979367	missense	probably benign	0.07
R7346:Fsip2	UTSW	2	82998180	missense	probably benign	0.00
R7389:Fsip2	UTSW	2	82988796	missense	possibly damaging	0.51
R7391:Fsip2	UTSW	2	82990319	missense	possibly damaging	0.70
R7397:Fsip2	UTSW	2	82985257	missense	possibly damaging	0.53
R7426:Fsip2	UTSW	2	82980097	missense	probably damaging	0.98
R7450:Fsip2	UTSW	2	82951680	missense	probably benign	0.30
R7538:Fsip2	UTSW	2	82988550	missense	possibly damaging	0.86
R7542:Fsip2	UTSW	2	82984852	missense	possibly damaging	0.96
R7549:Fsip2	UTSW	2	82993993	missense	probably damaging	0.99
R7564:Fsip2	UTSW	2	82989017	missense	probably benign	0.02
R7565:Fsip2	UTSW	2	82949512	missense	probably damaging	0.97
R7583:Fsip2	UTSW	2	82975241	missense	probably benign	0.12
R7641:Fsip2	UTSW	2	82986912	nonsense	probably null
R7655:Fsip2	UTSW	2	82977542	missense	possibly damaging	0.91
R7656:Fsip2	UTSW	2	82977542	missense	possibly damaging	0.91
R7665:Fsip2	UTSW	2	82981805	missense	probably benign	0.03
R7672:Fsip2	UTSW	2	82990111	missense	possibly damaging	0.93
R7764:Fsip2	UTSW	2	82980908	missense	possibly damaging	0.93
R7790:Fsip2	UTSW	2	82988379	missense	probably benign
R7811:Fsip2	UTSW	2	82998453	missense	possibly damaging	0.93
R7838:Fsip2	UTSW	2	82976700	missense	probably benign	0.00
R7873:Fsip2	UTSW	2	82949512	missense	probably damaging	0.97
R7902:Fsip2	UTSW	2	82977824	missense	possibly damaging	0.72
R7920:Fsip2	UTSW	2	82951021	missense	possibly damaging	0.94
R7959:Fsip2	UTSW	2	82985776	missense	possibly damaging	0.51
R8009:Fsip2	UTSW	2	82988449	missense	possibly damaging	0.85
R8031:Fsip2	UTSW	2	82986891	missense	probably benign
R8034:Fsip2	UTSW	2	82989355	missense	possibly damaging	0.92
R8037:Fsip2	UTSW	2	82985978	missense	possibly damaging	0.72
R8110:Fsip2	UTSW	2	82958673	missense	probably benign	0.00
R8117:Fsip2	UTSW	2	82992952	missense	possibly damaging	0.86
R8138:Fsip2	UTSW	2	82975797	missense	possibly damaging	0.83
R8175:Fsip2	UTSW	2	82984744	missense	probably benign	0.06
R8175:Fsip2	UTSW	2	82987677	missense	probably benign	0.16
R8182:Fsip2	UTSW	2	82976607	missense	probably damaging	0.99
R8206:Fsip2	UTSW	2	82990464	missense	possibly damaging	0.85
R8229:Fsip2	UTSW	2	82978143	missense	possibly damaging	0.63
R8239:Fsip2	UTSW	2	82989343	missense	possibly damaging	0.71
R8245:Fsip2	UTSW	2	82981002	missense	possibly damaging	0.79
R8303:Fsip2	UTSW	2	82988380	missense	probably benign	0.00
R8336:Fsip2	UTSW	2	82990755	missense	possibly damaging	0.53
R8347:Fsip2	UTSW	2	82987854	missense	probably benign	0.16
R8351:Fsip2	UTSW	2	82991895	missense	possibly damaging	0.73
R8352:Fsip2	UTSW	2	82984593	missense	probably benign
R8419:Fsip2	UTSW	2	82978619	missense	probably damaging	0.96
R8431:Fsip2	UTSW	2	82981566	missense	probably damaging	1.00
R8439:Fsip2	UTSW	2	82977086	missense	probably benign	0.24
R8452:Fsip2	UTSW	2	82984593	missense	probably benign
R8459:Fsip2	UTSW	2	82979678	missense	possibly damaging	0.95
R8465:Fsip2	UTSW	2	82979940	missense	probably benign	0.26
R8473:Fsip2	UTSW	2	82946992	missense	probably damaging	0.99
R8703:Fsip2	UTSW	2	82991527	missense	probably damaging	0.98
R8711:Fsip2	UTSW	2	82984902	missense	possibly damaging	0.53
R8713:Fsip2	UTSW	2	82981109	missense	probably damaging	1.00
R8789:Fsip2	UTSW	2	82985478	missense	possibly damaging	0.73
R8805:Fsip2	UTSW	2	82983109	missense	possibly damaging	0.46
R8840:Fsip2	UTSW	2	82991262	missense	probably benign	0.03
R8855:Fsip2	UTSW	2	82980177	missense	probably benign	0.04
R8866:Fsip2	UTSW	2	82980177	missense	probably benign	0.04
R8875:Fsip2	UTSW	2	82990438	missense	possibly damaging	0.95
R8883:Fsip2	UTSW	2	82979180	missense	possibly damaging	0.68
R8903:Fsip2	UTSW	2	82977337	missense	possibly damaging	0.83
R8907:Fsip2	UTSW	2	82986640	missense	probably benign	0.20
R8912:Fsip2	UTSW	2	82980594	missense	probably benign
R8926:Fsip2	UTSW	2	82993583	missense	possibly damaging	0.84
R8991:Fsip2	UTSW	2	82985026	missense	probably benign	0.33
R9014:Fsip2	UTSW	2	82976554	missense	probably benign	0.32
R9014:Fsip2	UTSW	2	82986731	missense	possibly damaging	0.71
R9039:Fsip2	UTSW	2	82998201	missense	probably benign	0.32
R9054:Fsip2	UTSW	2	82975836	missense	possibly damaging	0.68
R9114:Fsip2	UTSW	2	82976957	missense	probably benign	0.00
R9124:Fsip2	UTSW	2	82985759	missense	probably benign	0.00
R9131:Fsip2	UTSW	2	82982826	missense	probably benign
R9149:Fsip2	UTSW	2	82982030	missense	possibly damaging	0.86
R9180:Fsip2	UTSW	2	82985230	missense	possibly damaging	0.96
R9192:Fsip2	UTSW	2	82987500	missense	probably benign	0.06
R9216:Fsip2	UTSW	2	82990081	missense	probably damaging	0.99
R9218:Fsip2	UTSW	2	82992718	missense	probably damaging	0.97
R9222:Fsip2	UTSW	2	82985614	missense	probably benign	0.00
R9262:Fsip2	UTSW	2	82977318	missense	probably benign	0.00
R9340:Fsip2	UTSW	2	82988260	missense	possibly damaging	0.71
R9342:Fsip2	UTSW	2	82988403	missense	possibly damaging	0.71
R9368:Fsip2	UTSW	2	82980695	missense	possibly damaging	0.68
R9372:Fsip2	UTSW	2	82992412	missense	possibly damaging	0.71
R9385:Fsip2	UTSW	2	82989449	missense	possibly damaging	0.84
R9432:Fsip2	UTSW	2	82975563	missense	probably damaging	0.98
R9434:Fsip2	UTSW	2	82986358	missense	possibly damaging	0.71
R9445:Fsip2	UTSW	2	82975788	missense	probably damaging	0.99
R9472:Fsip2	UTSW	2	82986941	missense	possibly damaging	0.85
R9496:Fsip2	UTSW	2	82962718	missense	probably benign
R9523:Fsip2	UTSW	2	82977628	missense	probably damaging	0.99
R9567:Fsip2	UTSW	2	82967829	missense	probably benign
R9636:Fsip2	UTSW	2	82990219	missense	possibly damaging	0.52
R9643:Fsip2	UTSW	2	82991640	missense	possibly damaging	0.53
R9680:Fsip2	UTSW	2	82988928	missense	probably benign	0.32
R9695:Fsip2	UTSW	2	82975882	missense	probably benign
R9705:Fsip2	UTSW	2	82993290	missense	probably benign
R9739:Fsip2	UTSW	2	82993552	missense	possibly damaging	0.71
R9751:Fsip2	UTSW	2	82987897	missense	probably benign	0.00
R9761:Fsip2	UTSW	2	82991650	missense	probably benign	0.00
R9798:Fsip2	UTSW	2	82979881	nonsense	probably null
RF003:Fsip2	UTSW	2	82991521	missense	probably benign	0.02
RF005:Fsip2	UTSW	2	82992532	missense	probably benign	0.04
RF008:Fsip2	UTSW	2	82977840	missense	probably benign
RF028:Fsip2	UTSW	2	82994008	frame shift	probably null
RF029:Fsip2	UTSW	2	82994008	frame shift	probably null
RF036:Fsip2	UTSW	2	82984363	critical splice acceptor site	probably benign
RF038:Fsip2	UTSW	2	82994008	frame shift	probably null
RF062:Fsip2	UTSW	2	82984363	critical splice acceptor site	probably benign
X0018:Fsip2	UTSW	2	82982507	nonsense	probably null
X0020:Fsip2	UTSW	2	82951020	missense	probably damaging	1.00
X0025:Fsip2	UTSW	2	82954946	missense	possibly damaging	0.70
X0027:Fsip2	UTSW	2	82976778	missense	probably benign	0.35
X0066:Fsip2	UTSW	2	82987463	missense	possibly damaging	0.51
Z1088:Fsip2	UTSW	2	82975448	missense	probably damaging	0.96
Z1088:Fsip2	UTSW	2	82987653	missense	possibly damaging	0.86
Z1088:Fsip2	UTSW	2	82988634	missense	possibly damaging	0.85
Z1176:Fsip2	UTSW	2	82989665	missense	probably benign	0.02
Z1177:Fsip2	UTSW	2	82946960	missense	probably damaging	0.99
Z1177:Fsip2	UTSW	2	82984524	missense	probably damaging	0.98
Z1177:Fsip2	UTSW	2	82987203	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGCAGAAGCCTCACAAGTG -3'
(R):5'- CTGCATCTGAAAGCTCCTTTG -3'

Sequencing Primer
(F):5'- AAGATTCTGCACAGCTTGTTCCAG -3'
(R):5'- GCATCTGAAAGCTCCTTTGTCATTG -3'

Posted On

2014-08-01