Mutagenetix > Incidental Mutations

Incidental Mutation 'R1482:AI314180'

164432

Institutional Source

Beutler Lab

Gene Symbol

AI314180

Ensembl Gene

ENSMUSG00000050812

Gene Name

expressed sequence AI314180

Synonyms

MMRRC Submission

039535-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.343) question?

Stock #

R1482 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

58798911-58912749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58820163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1217 (K1217E)

Ref Sequence

ENSEMBL: ENSMUSP00000099953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]

AlphaFold

Q6PDI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102889
AA Change: K1217E

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: K1217E

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	1.1e-155	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1491	3e-31	SMART
low complexity region	1781	1797	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131611

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135601

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149301
AA Change: K1217E

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: K1217E

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	4e-163	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1490	8e-32	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 83.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	G	A	19: 3,717,192	D260N	probably benign	Het
Ankef1	A	T	2: 136,550,158	K422N	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Aqp6	A	T	15: 99,604,307	*294C	probably null	Het
Baz2a	T	A	10: 128,109,008	M38K	possibly damaging	Het
Bcl2l14	A	G	6: 134,427,302	D151G	probably damaging	Het
Cabp5	T	A	7: 13,398,342	L12*	probably null	Het
Cachd1	T	C	4: 100,988,598	V993A	possibly damaging	Het
Cd44	G	A	2: 102,831,383	T306I	probably damaging	Het
Cdc20	A	T	4: 118,437,056	N22K	probably benign	Het
Cdc6	T	A	11: 98,916,981	D433E	possibly damaging	Het
Clhc1	A	G	11: 29,553,725	D47G	probably damaging	Het
Csf2	T	C	11: 54,248,563	K65E	probably benign	Het
Cul9	T	C	17: 46,508,547	E2005G	probably damaging	Het
Dclk3	G	T	9: 111,467,820	R144L	possibly damaging	Het
Dcpp2	C	T	17: 23,900,542	T110I	probably damaging	Het
Disp1	A	T	1: 183,086,474	F1461I	possibly damaging	Het
Dnah1	C	T	14: 31,294,874	G1562D	probably damaging	Het
Exoc3l2	C	A	7: 19,495,359	P234Q	probably damaging	Het
F2rl2	T	C	13: 95,701,539	V364A	probably benign	Het
Fam151a	T	C	4: 106,745,679	L265P	probably damaging	Het
Fam151b	T	A	13: 92,450,166	Q253L	probably benign	Het
Fat1	G	A	8: 44,953,244	V1011M	probably benign	Het
Fbxo6	G	A	4: 148,145,984	R274*	probably null	Het
Fgd4	G	T	16: 16,484,473	Q73K	probably benign	Het
Fth1	A	G	19: 9,984,853	T154A	probably benign	Het
Hgs	C	A	11: 120,480,040	H572Q	probably benign	Het
Kcnk10	G	A	12: 98,489,948	T208I	probably damaging	Het
Kdm5b	G	A	1: 134,624,897	V1204M	probably damaging	Het
Keg1	A	C	19: 12,718,821	H166P	probably damaging	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Llcfc1	A	T	6: 41,685,284	D74V	probably damaging	Het
Lman2	A	G	13: 55,351,405	V219A	possibly damaging	Het
Mettl25	A	G	10: 105,826,590	I173T	possibly damaging	Het
Mov10	G	T	3: 104,804,546	P170Q	probably damaging	Het
Mtif2	G	T	11: 29,536,847	A286S	probably damaging	Het
Mtmr10	A	G	7: 64,314,249	Y244C	probably damaging	Het
Nbea	A	T	3: 56,079,993	C359S	probably damaging	Het
Nbr1	C	T	11: 101,572,841	T633I	probably benign	Het
Nepn	A	T	10: 52,400,416	T22S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Oacyl	T	A	18: 65,737,972	L342M	probably damaging	Het
Olfr691	T	A	7: 105,337,256	R153S	probably damaging	Het
Olfr699	A	G	7: 106,790,333	F223L	probably benign	Het
Olfr775	T	A	10: 129,251,143	I203N	possibly damaging	Het
Olfr872	G	A	9: 20,260,724	V295I	possibly damaging	Het
Oxnad1	T	C	14: 32,099,633		probably null	Het
Pard3b	A	T	1: 62,166,367	D440V	probably damaging	Het
Pou3f2	T	G	4: 22,486,960	D391A	possibly damaging	Het
Ptprk	T	C	10: 28,263,516	V79A	probably benign	Het
Rwdd2a	A	G	9: 86,574,278	D169G	probably damaging	Het
Scn3b	A	C	9: 40,279,496	D74A	probably damaging	Het
Setbp1	C	T	18: 79,086,835	D61N	probably damaging	Het
Setx	T	A	2: 29,162,992	D2089E	probably damaging	Het
Vmn2r69	C	G	7: 85,406,874	W685C	probably damaging	Het
Vps8	A	G	16: 21,581,598	Q1272R	probably benign	Het
Wnk4	T	C	11: 101,269,636	F699L	probably damaging	Het
Zfp616	T	A	11: 74,083,977	N448K	possibly damaging	Het
Zfp618	C	A	4: 63,115,448	D307E	possibly damaging	Het
Zfp687	A	G	3: 95,007,533	F1219S	probably damaging	Het
Zfpm2	T	A	15: 41,099,291	D248E	probably damaging	Het

Other mutations in AI314180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:AI314180	APN	4	58828047	missense	possibly damaging	0.95
IGL01145:AI314180	APN	4	58811501	missense	probably null	0.08
IGL01371:AI314180	APN	4	58809718	missense	probably damaging	1.00
IGL01445:AI314180	APN	4	58833988	missense	probably benign	0.08
IGL01452:AI314180	APN	4	58836181	missense	probably damaging	0.99
IGL01626:AI314180	APN	4	58832814	splice site	probably benign
IGL01672:AI314180	APN	4	58814041	missense	probably benign	0.40
IGL01943:AI314180	APN	4	58849937	missense	possibly damaging	0.91
IGL01944:AI314180	APN	4	58861544	missense	probably benign	0.42
IGL02190:AI314180	APN	4	58800190	missense	probably benign	0.12
IGL02272:AI314180	APN	4	58811731	missense	probably benign	0.00
IGL02435:AI314180	APN	4	58830325	splice site	probably benign
IGL02516:AI314180	APN	4	58877102	missense	probably damaging	1.00
IGL02540:AI314180	APN	4	58805534	splice site	probably benign
IGL02709:AI314180	APN	4	58872699	missense	possibly damaging	0.90
IGL02742:AI314180	APN	4	58840757	missense	probably damaging	0.96
IGL02812:AI314180	APN	4	58864343	splice site	probably benign
IGL02828:AI314180	APN	4	58875512	missense	possibly damaging	0.59
IGL03130:AI314180	APN	4	58800288	missense	probably benign
IGL03179:AI314180	APN	4	58832777	missense	probably damaging	1.00
IGL03237:AI314180	APN	4	58810668	missense	probably benign	0.40
IGL03344:AI314180	APN	4	58828538	missense	probably damaging	1.00
R1467_AI314180_588	UTSW	4	58832753	missense	probably benign
R1776_ai314180_007	UTSW	4	58879100	missense	probably damaging	1.00
R6298_AI314180_882	UTSW	4	58877157	missense	probably damaging	1.00
BB006:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
BB016:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0313:AI314180	UTSW	4	58811892	missense	probably benign	0.11
R0399:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R0487:AI314180	UTSW	4	58819155	missense	probably damaging	1.00
R0492:AI314180	UTSW	4	58864418	missense	probably damaging	1.00
R0705:AI314180	UTSW	4	58885366	critical splice donor site	probably null
R0847:AI314180	UTSW	4	58841439	missense	probably benign	0.14
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1529:AI314180	UTSW	4	58832701	splice site	probably null
R1771:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1776:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1822:AI314180	UTSW	4	58805539	critical splice donor site	probably null
R1864:AI314180	UTSW	4	58849942	missense	possibly damaging	0.62
R2029:AI314180	UTSW	4	58844165	nonsense	probably null
R2061:AI314180	UTSW	4	58824270	missense	probably damaging	1.00
R2125:AI314180	UTSW	4	58833978	missense	probably benign
R2266:AI314180	UTSW	4	58830332	critical splice donor site	probably null
R2889:AI314180	UTSW	4	58836165	missense	probably benign
R2902:AI314180	UTSW	4	58809691	missense	probably benign	0.31
R2903:AI314180	UTSW	4	58828622	missense	possibly damaging	0.50
R2925:AI314180	UTSW	4	58833928	nonsense	probably null
R4151:AI314180	UTSW	4	58836254	missense	possibly damaging	0.51
R4225:AI314180	UTSW	4	58847027	missense	probably damaging	1.00
R4486:AI314180	UTSW	4	58820086	intron	probably benign
R4576:AI314180	UTSW	4	58834708	intron	probably benign
R4580:AI314180	UTSW	4	58840751	missense	probably damaging	1.00
R4654:AI314180	UTSW	4	58834523	missense	possibly damaging	0.86
R4688:AI314180	UTSW	4	58840757	missense	probably damaging	0.96
R4726:AI314180	UTSW	4	58844191	missense	probably damaging	1.00
R4825:AI314180	UTSW	4	58850911	missense	probably damaging	0.99
R4928:AI314180	UTSW	4	58827073	missense	probably damaging	1.00
R5098:AI314180	UTSW	4	58877048	missense	probably damaging	1.00
R5284:AI314180	UTSW	4	58836172	missense	possibly damaging	0.90
R5375:AI314180	UTSW	4	58809401	nonsense	probably null
R5382:AI314180	UTSW	4	58850934	missense	probably benign	0.38
R5487:AI314180	UTSW	4	58809421	missense	probably benign	0.22
R5703:AI314180	UTSW	4	58877171	splice site	probably null
R5761:AI314180	UTSW	4	58853131	missense	probably damaging	1.00
R5791:AI314180	UTSW	4	58814027	missense	possibly damaging	0.90
R5791:AI314180	UTSW	4	58822111	missense	probably damaging	1.00
R5928:AI314180	UTSW	4	58849948	missense	possibly damaging	0.59
R6062:AI314180	UTSW	4	58826453	missense	possibly damaging	0.84
R6246:AI314180	UTSW	4	58811365	splice site	probably null
R6298:AI314180	UTSW	4	58877157	missense	probably damaging	1.00
R6326:AI314180	UTSW	4	58827068	missense	probably benign	0.34
R6478:AI314180	UTSW	4	58810785	missense	probably damaging	1.00
R6707:AI314180	UTSW	4	58879101	missense	possibly damaging	0.52
R6846:AI314180	UTSW	4	58814081	missense	possibly damaging	0.85
R6857:AI314180	UTSW	4	58814065	missense	probably damaging	1.00
R6951:AI314180	UTSW	4	58853114	critical splice donor site	probably null
R7088:AI314180	UTSW	4	58849766	missense	possibly damaging	0.93
R7302:AI314180	UTSW	4	58834593	missense	probably benign	0.43
R7337:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R7341:AI314180	UTSW	4	58809415	missense	possibly damaging	0.94
R7344:AI314180	UTSW	4	58824770	missense	probably benign	0.08
R7525:AI314180	UTSW	4	58847038	missense	possibly damaging	0.84
R7530:AI314180	UTSW	4	58815317	missense	probably damaging	0.99
R7533:AI314180	UTSW	4	58809411	missense	probably benign	0.12
R7557:AI314180	UTSW	4	58849691	missense	possibly damaging	0.85
R7698:AI314180	UTSW	4	58832660	missense	unknown
R7793:AI314180	UTSW	4	58853150	missense	probably damaging	1.00
R7892:AI314180	UTSW	4	58828593	missense	probably benign
R7894:AI314180	UTSW	4	58853708	missense	probably damaging	1.00
R7929:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R8010:AI314180	UTSW	4	58832681	missense	unknown
R8082:AI314180	UTSW	4	58807852	missense	probably benign	0.00
R8175:AI314180	UTSW	4	58872756	missense	probably damaging	1.00
R8191:AI314180	UTSW	4	58872587	critical splice donor site	probably null
R8326:AI314180	UTSW	4	58847093	missense	probably damaging	1.00
R8459:AI314180	UTSW	4	58821379	missense	probably damaging	1.00
R8683:AI314180	UTSW	4	58834515	missense	probably benign	0.31
R8747:AI314180	UTSW	4	58828632	missense	probably damaging	0.98
R8981:AI314180	UTSW	4	58801796	missense	probably benign
R9206:AI314180	UTSW	4	58875444	missense	probably damaging	1.00
R9208:AI314180	UTSW	4	58875444	missense	probably damaging	1.00
R9231:AI314180	UTSW	4	58875533	missense	probably damaging	1.00
R9249:AI314180	UTSW	4	58869427	missense	probably damaging	1.00
R9355:AI314180	UTSW	4	58844114	missense	probably benign	0.23
X0060:AI314180	UTSW	4	58840752	missense	possibly damaging	0.73
Z1177:AI314180	UTSW	4	58861614	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTTCAGGGTCAAAGCAAAAGTACACC -3'
(R):5'- TCTTTCAATGGGCAAAGAGGCTAACAG -3'

Sequencing Primer
(F):5'- AGTATAAGGAGACCCGCTTTC -3'
(R):5'- GCAAAGAGGCTAACAGAACAAC -3'

Posted On

2014-03-28