Incidental Mutation 'R2015:Plekha5'
ID222800
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 040024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R2015 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 140534564 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000203517] [ENSMUST00000203517] [ENSMUST00000203517] [ENSMUST00000203774] [ENSMUST00000203774] [ENSMUST00000204145] [ENSMUST00000204145] [ENSMUST00000204876] [ENSMUST00000204876] [ENSMUST00000204876] [ENSMUST00000204876]
Predicted Effect probably null
Transcript: ENSMUST00000087622
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087622
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122528
Predicted Effect probably null
Transcript: ENSMUST00000203517
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203517
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203517
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203517
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203774
SMART Domains Protein: ENSMUSP00000144832
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 477 511 4e-8 BLAST
low complexity region 512 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203774
SMART Domains Protein: ENSMUSP00000144832
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 477 511 4e-8 BLAST
low complexity region 512 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203955
Predicted Effect probably null
Transcript: ENSMUST00000203955
Predicted Effect probably null
Transcript: ENSMUST00000203955
Predicted Effect probably null
Transcript: ENSMUST00000203955
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000204876
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204876
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204876
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204876
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205255
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Bbs10 C T 10: 111,300,855 Q610* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mib2 C T 4: 155,657,880 G176D probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Pls1 A G 9: 95,761,365 V527A possibly damaging Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slc2a8 A C 2: 32,981,380 V136G probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
R7493:Plekha5 UTSW 6 140580435 missense probably benign 0.02
R7557:Plekha5 UTSW 6 140426545 missense probably damaging 0.96
R7743:Plekha5 UTSW 6 140555986 missense probably damaging 1.00
R7792:Plekha5 UTSW 6 140589224 missense possibly damaging 0.80
R7808:Plekha5 UTSW 6 140583914 missense probably damaging 1.00
R7910:Plekha5 UTSW 6 140526458 missense possibly damaging 0.89
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTAGAGCATGGAGTGTGTTG -3'
(R):5'- TGTGCCATGCTAGTACGTGC -3'

Sequencing Primer
(F):5'- GTTGGGACTTGGGACAGG -3'
(R):5'- GCTAGTACGTGCTTCCTAAAAGG -3'
Posted On2014-08-25