Incidental Mutation 'R2015:Aire'
ID 222846
Institutional Source Beutler Lab
Gene Symbol Aire
Ensembl Gene ENSMUSG00000000731
Gene Name autoimmune regulator
Synonyms
MMRRC Submission 040024-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2015 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77865856-77879444 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77878792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 85 (D85G)
Ref Sequence ENSEMBL: ENSMUSP00000115162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019257] [ENSMUST00000105395] [ENSMUST00000105396] [ENSMUST00000128241] [ENSMUST00000130972] [ENSMUST00000131028] [ENSMUST00000138785] [ENSMUST00000140636] [ENSMUST00000154374] [ENSMUST00000145975] [ENSMUST00000148469] [ENSMUST00000143735] [ENSMUST00000155021] [ENSMUST00000156417]
AlphaFold Q9Z0E3
Predicted Effect probably damaging
Transcript: ENSMUST00000019257
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019257
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 8.9e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
low complexity region 398 419 N/A INTRINSIC
PHD 432 475 7.82e-7 SMART
RING 433 474 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105395
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101034
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105396
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101035
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
PHD 373 416 7.82e-7 SMART
RING 374 415 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128241
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114904
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 5 104 3.3e-27 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
low complexity region 399 420 N/A INTRINSIC
PHD 433 476 7.82e-7 SMART
RING 434 475 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130972
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122659
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
low complexity region 394 415 N/A INTRINSIC
PHD 428 471 7.82e-7 SMART
RING 429 470 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131028
SMART Domains Protein: ENSMUSP00000114808
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 5 57 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135316
Predicted Effect probably benign
Transcript: ENSMUST00000138785
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000140636
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121477
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154374
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117094
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 7.4e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
PHD 374 417 7.82e-7 SMART
RING 375 416 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145975
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120150
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
RING 297 338 3.63e0 SMART
low complexity region 395 416 N/A INTRINSIC
PHD 429 472 7.82e-7 SMART
RING 430 471 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148469
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118317
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143735
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123678
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.1e-34 PFAM
SAND 198 264 2.61e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155021
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122190
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
PHD 369 412 7.82e-7 SMART
RING 370 411 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156417
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115162
Gene: ENSMUSG00000000731
AA Change: D85G

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143548
Meta Mutation Damage Score 0.7752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
PHENOTYPE: Targeted mutations that inactivate the gene result in immune system dysfunction characterized by multiorgan lymphocytic infiltration and circulating autoantibodies. Whereas one line is fertile, another exhibits male and female sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,022,672 (GRCm39) M1022K probably benign Het
Abhd4 T A 14: 54,500,289 (GRCm39) H74Q probably damaging Het
Actg1 A G 11: 120,237,636 (GRCm39) S49P possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Akr1c18 T A 13: 4,195,308 (GRCm39) D50V probably damaging Het
Ankrd13a C A 5: 114,930,170 (GRCm39) A185E probably damaging Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Armc8 A T 9: 99,365,158 (GRCm39) C661* probably null Het
Bbs10 C T 10: 111,136,716 (GRCm39) Q610* probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Bpifb9a T C 2: 154,110,120 (GRCm39) probably null Het
Cdk14 T C 5: 5,430,082 (GRCm39) K15R probably benign Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cep250 A C 2: 155,823,373 (GRCm39) H1009P probably damaging Het
Cfap97d1 C A 11: 101,878,044 (GRCm39) H35Q probably damaging Het
Clasp2 A G 9: 113,740,568 (GRCm39) T495A possibly damaging Het
Col19a1 C G 1: 24,598,834 (GRCm39) G53A unknown Het
Cpne1 G A 2: 155,920,308 (GRCm39) R166C probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ercc3 A G 18: 32,381,482 (GRCm39) T433A probably benign Het
Gm9936 T A 5: 114,995,482 (GRCm39) probably benign Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
H2ac25 T A 11: 58,845,754 (GRCm39) L64Q probably damaging Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Herpud1 T C 8: 95,118,834 (GRCm39) V196A probably benign Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kdm5a T C 6: 120,408,951 (GRCm39) S1545P probably benign Het
Klra8 C A 6: 130,092,536 (GRCm39) C255F probably damaging Het
Krtap4-6 A T 11: 99,556,398 (GRCm39) C110S unknown Het
Lef1 T A 3: 130,905,236 (GRCm39) I39N probably damaging Het
Lnpep G A 17: 17,799,325 (GRCm39) T110I probably damaging Het
Lrp1 T A 10: 127,376,563 (GRCm39) T4282S probably benign Het
Lrp6 A G 6: 134,457,337 (GRCm39) probably null Het
Ly6g5b A C 17: 35,333,654 (GRCm39) S53A possibly damaging Het
M6pr T G 6: 122,290,332 (GRCm39) N98K probably damaging Het
Mal2 T C 15: 54,464,136 (GRCm39) *176Q probably null Het
Mansc1 T C 6: 134,587,274 (GRCm39) D301G possibly damaging Het
Marchf1 C A 8: 66,574,473 (GRCm39) N11K probably damaging Het
Mast3 T A 8: 71,240,007 (GRCm39) I338F probably benign Het
Mcm3 A G 1: 20,873,804 (GRCm39) L772P probably damaging Het
Mib2 C T 4: 155,742,337 (GRCm39) G176D probably damaging Het
Mier2 A T 10: 79,377,036 (GRCm39) probably null Het
Mogs C T 6: 83,094,631 (GRCm39) R483* probably null Het
Msl2 G T 9: 100,957,304 (GRCm39) probably benign Het
Naa16 A T 14: 79,582,499 (GRCm39) M530K probably damaging Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Ndufb10 T C 17: 24,941,503 (GRCm39) probably null Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Npffr2 T A 5: 89,730,751 (GRCm39) I227N probably damaging Het
Nup210l T A 3: 90,092,739 (GRCm39) L1231Q probably damaging Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Pclo C A 5: 14,571,515 (GRCm39) P300Q probably damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plekha5 T A 6: 140,480,290 (GRCm39) probably null Het
Pls1 A G 9: 95,643,418 (GRCm39) V527A possibly damaging Het
Ppfia2 T C 10: 106,310,538 (GRCm39) M15T probably benign Het
Prkd2 T A 7: 16,581,602 (GRCm39) C152* probably null Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rbbp8 T C 18: 11,853,681 (GRCm39) M296T probably benign Het
Rfc3 T C 5: 151,571,003 (GRCm39) probably null Het
Rnf17 A G 14: 56,724,426 (GRCm39) N1090S probably benign Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sgta A T 10: 80,887,130 (GRCm39) V45E probably damaging Het
Slc25a46 A T 18: 31,742,778 (GRCm39) H29Q probably benign Het
Slc2a8 A C 2: 32,871,392 (GRCm39) V136G probably benign Het
Smg7 A T 1: 152,736,259 (GRCm39) N166K probably damaging Het
Spata21 C T 4: 140,834,640 (GRCm39) Q505* probably null Het
Strn4 T C 7: 16,566,953 (GRCm39) S458P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Trabd T A 15: 88,968,929 (GRCm39) M149K possibly damaging Het
Trpv3 A T 11: 73,170,653 (GRCm39) N178Y probably damaging Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsg101 C T 7: 46,558,652 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Unc13d A G 11: 115,959,581 (GRCm39) S631P probably damaging Het
Unc5d T C 8: 29,249,007 (GRCm39) T297A probably damaging Het
Usp18 A T 6: 121,245,509 (GRCm39) E1V probably damaging Het
Vapb C A 2: 173,613,391 (GRCm39) P97T probably benign Het
Vmn1r33 T A 6: 66,589,356 (GRCm39) D66V probably benign Het
Vmn2r19 T A 6: 123,292,954 (GRCm39) M332K probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdfy3 A C 5: 102,008,352 (GRCm39) S2778A probably null Het
Zbtb2 T A 10: 4,319,757 (GRCm39) I90F possibly damaging Het
Zfp518b C A 5: 38,829,345 (GRCm39) V887F probably benign Het
Zfp790 A G 7: 29,528,286 (GRCm39) T324A probably benign Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Aire
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Aire APN 10 77,872,557 (GRCm39) nonsense probably null
IGL01969:Aire APN 10 77,878,816 (GRCm39) missense probably damaging 1.00
Million UTSW 10 77,873,809 (GRCm39) missense probably damaging 1.00
BB008:Aire UTSW 10 77,866,130 (GRCm39) missense probably damaging 1.00
BB018:Aire UTSW 10 77,866,130 (GRCm39) missense probably damaging 1.00
E0370:Aire UTSW 10 77,877,897 (GRCm39) missense probably damaging 1.00
IGL03055:Aire UTSW 10 77,878,903 (GRCm39) missense probably damaging 1.00
R0326:Aire UTSW 10 77,878,433 (GRCm39) missense probably damaging 1.00
R0675:Aire UTSW 10 77,870,327 (GRCm39) splice site probably benign
R1748:Aire UTSW 10 77,879,314 (GRCm39) missense probably damaging 0.99
R1754:Aire UTSW 10 77,866,124 (GRCm39) missense probably damaging 1.00
R2014:Aire UTSW 10 77,878,792 (GRCm39) missense probably damaging 1.00
R3800:Aire UTSW 10 77,877,889 (GRCm39) splice site probably null
R5424:Aire UTSW 10 77,872,553 (GRCm39) missense probably damaging 1.00
R5517:Aire UTSW 10 77,875,525 (GRCm39) missense probably benign 0.14
R5983:Aire UTSW 10 77,878,903 (GRCm39) missense probably damaging 1.00
R6135:Aire UTSW 10 77,878,801 (GRCm39) missense probably damaging 1.00
R6856:Aire UTSW 10 77,866,089 (GRCm39) missense probably damaging 1.00
R7405:Aire UTSW 10 77,870,447 (GRCm39) missense probably benign 0.01
R7484:Aire UTSW 10 77,878,404 (GRCm39) missense probably damaging 1.00
R7606:Aire UTSW 10 77,873,767 (GRCm39) missense probably damaging 1.00
R7931:Aire UTSW 10 77,866,130 (GRCm39) missense probably damaging 1.00
R8867:Aire UTSW 10 77,873,809 (GRCm39) missense probably damaging 1.00
R8887:Aire UTSW 10 77,870,298 (GRCm39) missense probably damaging 0.96
R9115:Aire UTSW 10 77,879,309 (GRCm39) missense
R9562:Aire UTSW 10 77,871,579 (GRCm39) missense probably benign
R9623:Aire UTSW 10 77,873,809 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGGGGCACTCTTGAGG -3'
(R):5'- TCCCAAAGAGGCAGGAGTTG -3'

Sequencing Primer
(F):5'- GGCACTCTTGAGGACGAG -3'
(R):5'- TTGGAGAATGATATGCCCAGGTG -3'
Posted On 2014-08-25