Mutagenetix > Incidental Mutation

Incidental Mutation 'R2021:Clcn6'

223968

Institutional Source

Beutler Lab

Gene Symbol

Clcn6

Ensembl Gene

ENSMUSG00000029016

Gene Name

chloride channel, voltage-sensitive 6

Synonyms

MMRRC Submission

040030-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R2021 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148004259-148038821 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 148010652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]

AlphaFold

O35454

Predicted Effect

probably null
Transcript: ENSMUST00000030879

SMART Domains

Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	138	571	5.5e-98	PFAM
CBS	609	658	1.68e-3	SMART
CBS	811	859	1.34e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105711

SMART Domains

Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.5e-98	PFAM
CBS	612	661	1.68e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000137724

SMART Domains

Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.9e-101	PFAM
CBS	612	661	1.68e-3	SMART
CBS	814	862	1.34e-11	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,931,451	S462P	probably damaging	Het
Ablim1	A	T	19: 57,047,018	S316T	probably damaging	Het
Alox8	C	T	11: 69,186,288	V460I	probably damaging	Het
Arvcf	G	A	16: 18,399,732	A491T	probably damaging	Het
Asnsd1	A	G	1: 53,347,227	S414P	possibly damaging	Het
Btbd7	A	G	12: 102,790,709	L706P	probably damaging	Het
Camk2d	T	A	3: 126,780,456	W171R	probably damaging	Het
Casc3	T	A	11: 98,821,506	S124T	probably benign	Het
Casp8ap2	T	C	4: 32,644,560	V1211A	probably benign	Het
Ccdc182	T	C	11: 88,294,136	V14A	possibly damaging	Het
Ccdc80	A	T	16: 45,122,912	Q795L	probably damaging	Het
Ccdc88a	T	G	11: 29,503,480	S1614R	probably damaging	Het
Cubn	A	G	2: 13,308,549	V3070A	probably benign	Het
Dst	G	A	1: 34,166,291	V1025I	possibly damaging	Het
Dusp27	A	T	1: 166,100,823	W407R	probably benign	Het
Elk3	T	A	10: 93,265,677	I71F	probably damaging	Het
Flt3	A	T	5: 147,369,490	I276N	probably damaging	Het
Frem1	G	T	4: 82,913,558	T1988K	probably benign	Het
Gm597	A	T	1: 28,778,153	V266D	probably damaging	Het
Golph3l	T	A	3: 95,617,357	D306E	probably benign	Het
Grk2	T	A	19: 4,290,670	I254F	probably damaging	Het
Hgf	C	T	5: 16,576,921	T214I	probably benign	Het
Hoxc5	C	A	15: 103,014,382		probably null	Het
Hsd11b1	T	C	1: 193,240,378	T124A	probably benign	Het
Ipp	A	G	4: 116,515,368	Y198C	probably benign	Het
Ism1	T	A	2: 139,740,127		probably null	Het
Klhl42	A	G	6: 147,091,896	Y122C	possibly damaging	Het
Klk1b21	A	T	7: 44,105,994	K206*	probably null	Het
Lcn11	A	G	2: 25,778,085	K85R	probably benign	Het
Macf1	G	T	4: 123,472,730	A2746E	probably damaging	Het
Matn4	A	G	2: 164,400,653	V175A	probably damaging	Het
Myh2	A	T	11: 67,191,719	N1372Y	probably damaging	Het
Ncl	A	G	1: 86,356,955		probably null	Het
Nudt2	A	G	4: 41,480,255	D46G	probably damaging	Het
Obscn	C	T	11: 59,067,174	D3567N	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr346	G	C	2: 36,688,475	V158L	probably benign	Het
Olfr373	G	T	8: 72,100,086	V109F	possibly damaging	Het
Pamr1	T	A	2: 102,634,535	M343K	probably benign	Het
Pcdh15	T	G	10: 74,631,193	S1684A	possibly damaging	Het
Ppm1h	T	A	10: 122,878,528	L324*	probably null	Het
Ppp3r2	T	C	4: 49,681,723	I76V	probably benign	Het
Prkdc	G	A	16: 15,677,009	V748I	probably benign	Het
Prss47	A	G	13: 65,051,777	V96A	probably benign	Het
Rsbn1	C	T	3: 103,914,473	T8I	probably benign	Het
Rsf1	GGCG	GGCGACGGCGGCG	7: 97,579,906		probably benign	Het
Serpinb3d	A	G	1: 107,078,452	V302A	probably benign	Het
Sfrp4	A	T	13: 19,632,326	I177F	probably benign	Het
Sh3bp2	A	G	5: 34,544,225		probably benign	Het
Slc7a12	A	G	3: 14,497,333	T257A	probably damaging	Het
Specc1l	T	C	10: 75,267,591		probably null	Het
Stard9	A	G	2: 120,704,235	T3658A	probably benign	Het
Tctex1d4	A	G	4: 117,128,307	E109G	possibly damaging	Het
Tmem2	G	A	19: 21,844,750	A1170T	possibly damaging	Het
Tmem30c	T	C	16: 57,281,362	T68A	probably damaging	Het
Tnr	A	G	1: 159,852,022	I189V	probably benign	Het
Trrap	A	G	5: 144,853,488	N3586S	possibly damaging	Het
Usp14	T	C	18: 10,024,632	T22A	probably damaging	Het
Vmn1r68	A	G	7: 10,527,991	L60P	probably damaging	Het
Vmn2r108	G	A	17: 20,470,990	H424Y	probably benign	Het
Wdr81	C	A	11: 75,445,962	E1534*	probably null	Het
Zc3h13	A	G	14: 75,330,195	E976G	probably damaging	Het
Zfp128	T	C	7: 12,890,029	L108P	possibly damaging	Het
Zfp644	T	C	5: 106,635,682	I1000V	possibly damaging	Het

Other mutations in Clcn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Clcn6	APN	4	148017902	critical splice donor site	probably null
IGL00434:Clcn6	APN	4	148013738	missense	probably damaging	1.00
IGL00973:Clcn6	APN	4	148013788	splice site	probably benign
IGL01384:Clcn6	APN	4	148018966	missense	probably damaging	1.00
IGL01465:Clcn6	APN	4	148021451	splice site	probably benign
IGL01522:Clcn6	APN	4	148017535	missense	probably benign	0.44
R0194:Clcn6	UTSW	4	148012756	missense	probably damaging	1.00
R0280:Clcn6	UTSW	4	148008715	missense	probably damaging	1.00
R0349:Clcn6	UTSW	4	148024194	missense	possibly damaging	0.89
R0352:Clcn6	UTSW	4	148014606	missense	probably damaging	1.00
R0586:Clcn6	UTSW	4	148038749	unclassified	probably benign
R0927:Clcn6	UTSW	4	148029392	missense	probably benign	0.30
R1141:Clcn6	UTSW	4	148013899	missense	probably damaging	0.99
R1465:Clcn6	UTSW	4	148013901	missense	probably damaging	1.00
R1465:Clcn6	UTSW	4	148013901	missense	probably damaging	1.00
R1473:Clcn6	UTSW	4	148024156	missense	possibly damaging	0.93
R1551:Clcn6	UTSW	4	148012778	missense	possibly damaging	0.74
R1571:Clcn6	UTSW	4	148012769	missense	possibly damaging	0.63
R1593:Clcn6	UTSW	4	148014594	missense	probably benign
R1596:Clcn6	UTSW	4	148023379	missense	probably damaging	1.00
R1706:Clcn6	UTSW	4	148017568	missense	probably benign	0.00
R1769:Clcn6	UTSW	4	148014301	splice site	probably null
R2022:Clcn6	UTSW	4	148010652	critical splice donor site	probably null
R2049:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2081:Clcn6	UTSW	4	148011068	missense	probably damaging	1.00
R2140:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2141:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2142:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2177:Clcn6	UTSW	4	148014600	missense	possibly damaging	0.73
R2511:Clcn6	UTSW	4	148017494	critical splice donor site	probably null
R2891:Clcn6	UTSW	4	148012616	critical splice donor site	probably null
R3750:Clcn6	UTSW	4	148024187	nonsense	probably null
R4014:Clcn6	UTSW	4	148017610	missense	probably damaging	0.98
R4023:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4024:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4025:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4667:Clcn6	UTSW	4	148024167	missense	possibly damaging	0.61
R4865:Clcn6	UTSW	4	148019766	missense	probably damaging	1.00
R4978:Clcn6	UTSW	4	148008770	missense	probably benign	0.05
R5140:Clcn6	UTSW	4	148038317	unclassified	probably benign
R5345:Clcn6	UTSW	4	148038749	unclassified	probably benign
R5467:Clcn6	UTSW	4	148017636	missense	possibly damaging	0.81
R5665:Clcn6	UTSW	4	148014561	missense	possibly damaging	0.71
R5739:Clcn6	UTSW	4	148014189	missense	probably damaging	1.00
R5899:Clcn6	UTSW	4	148017592	missense	probably benign	0.01
R6043:Clcn6	UTSW	4	148008788	missense	probably damaging	1.00
R6351:Clcn6	UTSW	4	148017500	missense	probably benign	0.01
R6593:Clcn6	UTSW	4	148010769	missense	probably benign	0.21
R7440:Clcn6	UTSW	4	148014195	missense	probably damaging	1.00
R7674:Clcn6	UTSW	4	148012694	missense	probably damaging	1.00
R7756:Clcn6	UTSW	4	148029439	missense	probably damaging	1.00
R7901:Clcn6	UTSW	4	148010745	missense	probably damaging	1.00
R8559:Clcn6	UTSW	4	148026575	missense	possibly damaging	0.88
R8747:Clcn6	UTSW	4	148008897	critical splice donor site	probably null
R9246:Clcn6	UTSW	4	148029409	missense	probably benign	0.25
R9343:Clcn6	UTSW	4	148014001	missense	probably benign	0.03
V7732:Clcn6	UTSW	4	148013955	missense	probably damaging	0.96
Z1177:Clcn6	UTSW	4	148023370	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGCTGGAGTCAACTTGC -3'
(R):5'- CCTTGTTGCTGGAGAGTACG -3'

Sequencing Primer
(F):5'- GGAGTCAACTTGCCCTCAC -3'
(R):5'- ATACGAGGCAGCGTCTGG -3'

Posted On

2014-08-25