Incidental Mutation 'R2083:Ly6e'
ID 230168
Institutional Source Beutler Lab
Gene Symbol Ly6e
Ensembl Gene ENSMUSG00000022587
Gene Name lymphocyte antigen 6 complex, locus E
Synonyms RIG-E, TSA-1, Tsa1, Sca-2, Ly67, 9804
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 74955051-74959905 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74958319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 41 (C41S)
Ref Sequence ENSEMBL: ENSMUSP00000139549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051698] [ENSMUST00000169343] [ENSMUST00000185861] [ENSMUST00000185863] [ENSMUST00000187284] [ENSMUST00000187606] [ENSMUST00000188042] [ENSMUST00000189186] [ENSMUST00000190810] [ENSMUST00000191145] [ENSMUST00000191436] [ENSMUST00000188866] [ENSMUST00000191127]
AlphaFold Q64253
Predicted Effect probably damaging
Transcript: ENSMUST00000051698
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056703
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169343
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132081
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185861
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141145
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185863
AA Change: C57S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140060
Gene: ENSMUSG00000022587
AA Change: C57S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
LU 43 111 5.7e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186927
Predicted Effect probably damaging
Transcript: ENSMUST00000187284
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140553
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187606
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139471
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188042
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141059
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188686
Predicted Effect probably damaging
Transcript: ENSMUST00000189186
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139477
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPAR_LY6 29 64 3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190810
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139482
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 4.1e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191145
AA Change: C56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140829
Gene: ENSMUSG00000022587
AA Change: C56S

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
LU 42 117 2.4e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191436
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139549
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188866
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140145
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191127
AA Change: C41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139966
Gene: ENSMUSG00000022587
AA Change: C41S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 4.1e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191439
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos as a result of heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Adgra1 T C 7: 139,875,631 S392P probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Klhl22 A G 16: 17,776,525 T173A probably benign Het
Mapkbp1 T C 2: 120,015,482 L444P possibly damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Mlh3 A G 12: 85,269,041 F124L probably benign Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Pter T A 2: 12,978,436 L84Q probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Tubgcp6 A T 15: 89,122,376 Y148N probably damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Ly6e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Ly6e APN 15 74958697 missense probably benign 0.38
R0926:Ly6e UTSW 15 74958370 missense probably damaging 0.99
R2374:Ly6e UTSW 15 74958621 missense probably damaging 1.00
R4328:Ly6e UTSW 15 74958521 missense probably damaging 0.97
R4512:Ly6e UTSW 15 74957833 missense probably damaging 1.00
R4646:Ly6e UTSW 15 74958661 splice site probably null
R7509:Ly6e UTSW 15 74958286 missense probably damaging 1.00
R7706:Ly6e UTSW 15 74958334 missense possibly damaging 0.90
R7892:Ly6e UTSW 15 74957851 nonsense probably null
R8431:Ly6e UTSW 15 74958341 missense probably benign 0.00
R9087:Ly6e UTSW 15 74957800 missense probably benign 0.01
R9401:Ly6e UTSW 15 74958304 nonsense probably null
R9795:Ly6e UTSW 15 74958541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAGTTGTCATTGGCTGGC -3'
(R):5'- GGTTGACATTCCCTGCATGG -3'

Sequencing Primer
(F):5'- TGACCCAGGGCTGAGCATG -3'
(R):5'- CATTCCCTGCATGGAAAGTG -3'
Posted On 2014-09-18