Incidental Mutation 'R2083:Nlrp1a'
ID 230159
Institutional Source Beutler Lab
Gene Symbol Nlrp1a
Ensembl Gene ENSMUSG00000069830
Gene Name NLR family, pyrin domain containing 1A
Synonyms Nalp1
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70983062-71035530 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71015046 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 68 (L68H)
Ref Sequence ENSEMBL: ENSMUSP00000104158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048514] [ENSMUST00000108518]
AlphaFold Q2LKU9
Predicted Effect possibly damaging
Transcript: ENSMUST00000048514
AA Change: L68H

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038186
Gene: ENSMUSG00000069830
AA Change: L68H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 4.6e-41 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 742 769 3.04e-5 SMART
low complexity region 856 870 N/A INTRINSIC
Pfam:FIIND 921 1173 1.6e-102 PFAM
Pfam:CARD 1209 1292 2.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108518
AA Change: L68H

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104158
Gene: ENSMUSG00000069830
AA Change: L68H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 1.1e-40 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 661 688 2.85e1 SMART
LRR 689 716 3.04e-5 SMART
Pfam:FIIND 819 1073 3e-136 PFAM
Pfam:CARD 1091 1174 8.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Nlrp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Nlrp1a APN 11 70,983,783 (GRCm39) missense probably benign 0.00
IGL00771:Nlrp1a APN 11 71,013,567 (GRCm39) nonsense probably null
IGL01408:Nlrp1a APN 11 71,013,742 (GRCm39) missense probably benign 0.04
IGL01886:Nlrp1a APN 11 71,014,327 (GRCm39) missense probably benign
IGL02221:Nlrp1a APN 11 71,013,944 (GRCm39) missense possibly damaging 0.88
IGL02291:Nlrp1a APN 11 71,013,415 (GRCm39) critical splice donor site probably null
IGL02375:Nlrp1a APN 11 71,004,339 (GRCm39) nonsense probably null
IGL02408:Nlrp1a APN 11 71,013,456 (GRCm39) missense probably benign 0.00
IGL02516:Nlrp1a APN 11 71,005,286 (GRCm39) missense probably damaging 1.00
IGL02583:Nlrp1a APN 11 71,014,227 (GRCm39) missense probably benign 0.03
IGL02622:Nlrp1a APN 11 71,013,826 (GRCm39) missense possibly damaging 0.88
IGL02642:Nlrp1a APN 11 71,014,358 (GRCm39) missense probably benign 0.12
IGL02823:Nlrp1a APN 11 70,983,249 (GRCm39) missense probably damaging 0.96
IGL02859:Nlrp1a APN 11 70,996,912 (GRCm39) missense possibly damaging 0.57
IGL02997:Nlrp1a APN 11 71,014,491 (GRCm39) missense probably damaging 1.00
IGL03342:Nlrp1a APN 11 71,013,617 (GRCm39) missense probably benign 0.19
Ants UTSW 11 71,033,164 (GRCm39) missense probably benign 0.01
dreary UTSW 11 71,004,466 (GRCm39) critical splice acceptor site probably null
picnic UTSW 11 71,013,573 (GRCm39) missense possibly damaging 0.87
seedless UTSW 11 71,014,378 (GRCm39) missense probably benign 0.44
watermelon UTSW 11 71,013,531 (GRCm39) missense probably benign 0.08
R0022:Nlrp1a UTSW 11 71,014,207 (GRCm39) missense probably damaging 0.99
R0345:Nlrp1a UTSW 11 71,014,501 (GRCm39) missense probably damaging 1.00
R0360:Nlrp1a UTSW 11 71,004,830 (GRCm39) intron probably benign
R0364:Nlrp1a UTSW 11 71,004,830 (GRCm39) intron probably benign
R0566:Nlrp1a UTSW 11 71,013,768 (GRCm39) missense probably benign 0.00
R1177:Nlrp1a UTSW 11 70,998,547 (GRCm39) missense probably damaging 1.00
R1240:Nlrp1a UTSW 11 71,004,292 (GRCm39) critical splice donor site probably null
R1263:Nlrp1a UTSW 11 70,987,948 (GRCm39) missense probably benign 0.01
R1681:Nlrp1a UTSW 11 71,033,184 (GRCm39) missense unknown
R1743:Nlrp1a UTSW 11 71,015,032 (GRCm39) missense probably benign 0.04
R1826:Nlrp1a UTSW 11 71,013,573 (GRCm39) missense possibly damaging 0.87
R1826:Nlrp1a UTSW 11 70,998,806 (GRCm39) intron probably benign
R1981:Nlrp1a UTSW 11 70,989,764 (GRCm39) missense probably damaging 1.00
R2116:Nlrp1a UTSW 11 71,005,326 (GRCm39) nonsense probably null
R2134:Nlrp1a UTSW 11 71,015,014 (GRCm39) missense probably benign 0.00
R2148:Nlrp1a UTSW 11 71,013,733 (GRCm39) nonsense probably null
R2301:Nlrp1a UTSW 11 70,996,927 (GRCm39) missense possibly damaging 0.94
R3029:Nlrp1a UTSW 11 71,014,456 (GRCm39) missense probably damaging 1.00
R3113:Nlrp1a UTSW 11 71,014,491 (GRCm39) missense probably damaging 1.00
R3801:Nlrp1a UTSW 11 71,013,529 (GRCm39) missense probably benign 0.08
R3898:Nlrp1a UTSW 11 71,013,700 (GRCm39) missense probably benign 0.00
R4254:Nlrp1a UTSW 11 71,013,854 (GRCm39) nonsense probably null
R4397:Nlrp1a UTSW 11 70,988,030 (GRCm39) missense probably benign 0.00
R4647:Nlrp1a UTSW 11 70,987,952 (GRCm39) splice site probably null
R4740:Nlrp1a UTSW 11 71,004,466 (GRCm39) critical splice acceptor site probably null
R4965:Nlrp1a UTSW 11 70,983,141 (GRCm39) missense possibly damaging 0.94
R5009:Nlrp1a UTSW 11 71,013,531 (GRCm39) missense probably benign 0.08
R5103:Nlrp1a UTSW 11 70,990,352 (GRCm39) missense probably damaging 0.99
R5355:Nlrp1a UTSW 11 71,015,077 (GRCm39) missense probably benign 0.00
R5577:Nlrp1a UTSW 11 70,990,400 (GRCm39) missense probably damaging 1.00
R5892:Nlrp1a UTSW 11 70,990,471 (GRCm39) missense probably damaging 1.00
R5949:Nlrp1a UTSW 11 70,989,815 (GRCm39) missense probably damaging 1.00
R5964:Nlrp1a UTSW 11 71,013,846 (GRCm39) missense probably benign 0.00
R6220:Nlrp1a UTSW 11 71,033,164 (GRCm39) missense probably benign 0.01
R6564:Nlrp1a UTSW 11 71,014,398 (GRCm39) missense probably damaging 1.00
R6586:Nlrp1a UTSW 11 70,996,899 (GRCm39) missense probably benign 0.00
R6925:Nlrp1a UTSW 11 70,983,339 (GRCm39) missense probably null 0.99
R7013:Nlrp1a UTSW 11 71,014,378 (GRCm39) missense probably benign 0.44
R7155:Nlrp1a UTSW 11 71,014,905 (GRCm39) missense possibly damaging 0.93
R7214:Nlrp1a UTSW 11 71,014,119 (GRCm39) missense probably damaging 1.00
R7268:Nlrp1a UTSW 11 71,015,068 (GRCm39) missense probably benign 0.00
R7388:Nlrp1a UTSW 11 71,014,023 (GRCm39) missense probably damaging 1.00
R7404:Nlrp1a UTSW 11 70,987,919 (GRCm39) nonsense probably null
R7409:Nlrp1a UTSW 11 71,013,634 (GRCm39) missense probably benign 0.03
R7410:Nlrp1a UTSW 11 71,014,683 (GRCm39) missense probably damaging 0.99
R7440:Nlrp1a UTSW 11 70,983,150 (GRCm39) missense probably damaging 0.99
R7447:Nlrp1a UTSW 11 70,983,237 (GRCm39) missense probably damaging 1.00
R7450:Nlrp1a UTSW 11 70,998,484 (GRCm39) missense probably damaging 1.00
R7569:Nlrp1a UTSW 11 70,999,869 (GRCm39) missense probably benign 0.00
R7600:Nlrp1a UTSW 11 70,989,740 (GRCm39) missense probably damaging 0.96
R7634:Nlrp1a UTSW 11 70,990,354 (GRCm39) missense probably benign 0.19
R7734:Nlrp1a UTSW 11 70,998,826 (GRCm39) missense unknown
R7747:Nlrp1a UTSW 11 71,014,234 (GRCm39) missense possibly damaging 0.85
R8471:Nlrp1a UTSW 11 71,013,885 (GRCm39) missense possibly damaging 0.68
R8482:Nlrp1a UTSW 11 70,999,901 (GRCm39) splice site probably null
R9008:Nlrp1a UTSW 11 71,014,735 (GRCm39) missense possibly damaging 0.89
R9028:Nlrp1a UTSW 11 71,013,819 (GRCm39) missense probably benign 0.27
R9441:Nlrp1a UTSW 11 71,013,934 (GRCm39) missense probably damaging 1.00
R9516:Nlrp1a UTSW 11 70,998,488 (GRCm39) missense probably benign 0.05
R9701:Nlrp1a UTSW 11 70,987,946 (GRCm39) missense probably benign 0.08
X0026:Nlrp1a UTSW 11 71,033,142 (GRCm39) missense probably benign 0.18
Z1177:Nlrp1a UTSW 11 71,013,995 (GRCm39) missense probably benign 0.27
Z1186:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Z1186:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1186:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1186:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1186:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1187:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1187:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1187:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1187:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1187:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Z1188:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1188:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1188:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1188:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1188:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Z1189:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1189:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1189:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1189:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1189:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Z1190:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1190:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1190:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1190:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1190:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Z1191:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1191:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1191:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1191:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1191:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Z1192:Nlrp1a UTSW 11 70,990,442 (GRCm39) missense probably benign
Z1192:Nlrp1a UTSW 11 70,988,077 (GRCm39) missense probably damaging 0.96
Z1192:Nlrp1a UTSW 11 70,983,069 (GRCm39) missense probably benign
Z1192:Nlrp1a UTSW 11 71,033,355 (GRCm39) critical splice acceptor site probably null
Z1192:Nlrp1a UTSW 11 71,014,914 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGTACCTAAGTTTGGGCC -3'
(R):5'- CAATGCTCACAGACTGTATGATG -3'

Sequencing Primer
(F):5'- GGGCCAAATAAATCTTGGATGTC -3'
(R):5'- GTACAGTTTAGACAGATGTCT -3'
Posted On 2014-09-18