Incidental Mutation 'R2083:Klhl22'
ID230171
Institutional Source Beutler Lab
Gene Symbol Klhl22
Ensembl Gene ENSMUSG00000022750
Gene Namekelch-like 22
SynonymsKelchl, 2610318I18Rik
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R2083 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17759618-17793382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17776525 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 173 (T173A)
Ref Sequence ENSEMBL: ENSMUSP00000127227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117192] [ENSMUST00000120488] [ENSMUST00000126600] [ENSMUST00000129199] [ENSMUST00000129299] [ENSMUST00000140306] [ENSMUST00000165790]
Predicted Effect probably benign
Transcript: ENSMUST00000117192
AA Change: T173A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114115
Gene: ENSMUSG00000022750
AA Change: T173A

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120488
AA Change: T173A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112412
Gene: ENSMUSG00000022750
AA Change: T173A

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126600
SMART Domains Protein: ENSMUSP00000118696
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
Pfam:BTB 40 115 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129199
SMART Domains Protein: ENSMUSP00000119191
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 117 3.1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129299
Predicted Effect probably benign
Transcript: ENSMUST00000140306
SMART Domains Protein: ENSMUSP00000122145
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 130 5.11e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144116
Predicted Effect probably benign
Transcript: ENSMUST00000165790
AA Change: T173A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127227
Gene: ENSMUSG00000022750
AA Change: T173A

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Adgra1 T C 7: 139,875,631 S392P probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Ly6e T A 15: 74,958,319 C41S probably damaging Het
Mapkbp1 T C 2: 120,015,482 L444P possibly damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Mlh3 A G 12: 85,269,041 F124L probably benign Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Pter T A 2: 12,978,436 L84Q probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Tubgcp6 A T 15: 89,122,376 Y148N probably damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Klhl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Klhl22 APN 16 17776462 missense probably benign 0.03
IGL01973:Klhl22 APN 16 17792711 missense probably benign 0.00
IGL02115:Klhl22 APN 16 17776595 missense probably damaging 0.99
IGL02383:Klhl22 APN 16 17776898 missense possibly damaging 0.60
IGL03381:Klhl22 APN 16 17792727 missense possibly damaging 0.71
R0562:Klhl22 UTSW 16 17792624 missense probably benign
R0811:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R0812:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R1661:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1665:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1732:Klhl22 UTSW 16 17777024 missense probably damaging 1.00
R1902:Klhl22 UTSW 16 17771787 missense probably damaging 1.00
R2042:Klhl22 UTSW 16 17792420 unclassified probably benign
R4368:Klhl22 UTSW 16 17789273 missense possibly damaging 0.94
R4860:Klhl22 UTSW 16 17777016 synonymous silent
R6413:Klhl22 UTSW 16 17789317 missense probably benign 0.01
R7031:Klhl22 UTSW 16 17777026 missense probably damaging 1.00
R7095:Klhl22 UTSW 16 17792750 missense probably damaging 0.98
R7378:Klhl22 UTSW 16 17776805 missense probably damaging 1.00
R7565:Klhl22 UTSW 16 17789284 missense probably damaging 1.00
R8051:Klhl22 UTSW 16 17792579 missense probably damaging 0.99
R8153:Klhl22 UTSW 16 17792550 missense probably damaging 0.99
R8670:Klhl22 UTSW 16 17776463 missense probably damaging 0.99
R8732:Klhl22 UTSW 16 17771826 missense probably damaging 0.98
Z1088:Klhl22 UTSW 16 17776543 missense possibly damaging 0.86
Z1176:Klhl22 UTSW 16 17776696 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AATATTCAGATGCAGTCCTCCAG -3'
(R):5'- AAAGCGCACAGTCTCTAGGAG -3'

Sequencing Primer
(F):5'- AGTCCTCCAGCTAAGACTTGAGTG -3'
(R):5'- CATTCAGTGAGATCTGGTCAGCC -3'
Posted On2014-09-18