Mutagenetix > Incidental Mutation

Incidental Mutation 'R2083:Ttll7'

230133

Institutional Source

Beutler Lab

Gene Symbol

Ttll7

Ensembl Gene

ENSMUSG00000036745

Gene Name

tubulin tyrosine ligase-like family, member 7

Synonyms

1110049N09Rik, 4921517B04Rik

MMRRC Submission

040088-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.467) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146852367-146984009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146930104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 398 (R398G)

Ref Sequence

ENSEMBL: ENSMUSP00000129369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037942
AA Change: R398G

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000038090

SMART Domains

Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	9e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC
low complexity region	591	601	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106134
AA Change: R398G

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: R398G

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	7.2e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170055
AA Change: R398G

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: R398G

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	5.9e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Adgra1	T	C	7: 139,875,631	S392P	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Ambra1	T	A	2: 91,766,600	I12N	possibly damaging	Het
Atp10b	A	G	11: 43,212,423	T545A	probably benign	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Mlh3	A	G	12: 85,269,041	F124L	probably benign	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Olfr26	T	G	9: 38,855,341	V93G	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Ptpn4	A	G	1: 119,687,759	L555P	possibly damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Ttll7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ttll7	APN	3	146909582	missense	possibly damaging	0.72
IGL01353:Ttll7	APN	3	146961719	missense	probably damaging	1.00
IGL01415:Ttll7	APN	3	146909599	missense	possibly damaging	0.90
IGL01843:Ttll7	APN	3	146940021	missense	possibly damaging	0.93
IGL03101:Ttll7	APN	3	146896690	missense	possibly damaging	0.82
IGL03378:Ttll7	APN	3	146909653	missense	probably benign	0.06
P0038:Ttll7	UTSW	3	146945184	missense	possibly damaging	0.80
R0265:Ttll7	UTSW	3	146944160	nonsense	probably null
R0358:Ttll7	UTSW	3	146944116	missense	probably benign
R0363:Ttll7	UTSW	3	146944215	missense	probably benign	0.00
R0364:Ttll7	UTSW	3	146945181	missense	possibly damaging	0.82
R0751:Ttll7	UTSW	3	146939991	missense	probably damaging	1.00
R1184:Ttll7	UTSW	3	146939991	missense	probably damaging	1.00
R1533:Ttll7	UTSW	3	146896667	missense	probably damaging	1.00
R1771:Ttll7	UTSW	3	146894405	missense	probably benign	0.02
R1789:Ttll7	UTSW	3	146915780	missense	probably damaging	1.00
R1961:Ttll7	UTSW	3	146915795	splice site	probably benign
R1995:Ttll7	UTSW	3	146961755	missense	possibly damaging	0.95
R2152:Ttll7	UTSW	3	146930189	missense	probably damaging	1.00
R2655:Ttll7	UTSW	3	146947621	missense	probably damaging	1.00
R2926:Ttll7	UTSW	3	146930415	nonsense	probably null
R4888:Ttll7	UTSW	3	146894177	start codon destroyed	probably null	0.99
R4999:Ttll7	UTSW	3	146894469	missense	probably damaging	1.00
R5648:Ttll7	UTSW	3	146961710	missense	probably damaging	1.00
R5937:Ttll7	UTSW	3	146944092	nonsense	probably null
R6009:Ttll7	UTSW	3	146934535	missense	probably damaging	0.99
R6036:Ttll7	UTSW	3	146940162	missense	probably benign
R6036:Ttll7	UTSW	3	146940162	missense	probably benign
R6463:Ttll7	UTSW	3	146931582	missense	possibly damaging	0.86
R6747:Ttll7	UTSW	3	146944056	missense	probably benign	0.02
R6922:Ttll7	UTSW	3	146909614	missense	possibly damaging	0.92
R7123:Ttll7	UTSW	3	146913296	missense	possibly damaging	0.95
R7211:Ttll7	UTSW	3	146913276	missense	probably damaging	0.97
R8229:Ttll7	UTSW	3	146901449	missense	probably damaging	0.99
R8406:Ttll7	UTSW	3	146940024	missense	probably benign
R9343:Ttll7	UTSW	3	146961742	missense	probably damaging	1.00
R9348:Ttll7	UTSW	3	146968013	missense	probably benign	0.31
R9629:Ttll7	UTSW	3	146915732	missense	probably damaging	1.00
RF015:Ttll7	UTSW	3	146979658	missense	probably benign	0.00
X0024:Ttll7	UTSW	3	146909553	missense	probably damaging	1.00
X0026:Ttll7	UTSW	3	146961695	missense	probably damaging	1.00
X0027:Ttll7	UTSW	3	146947653	missense	probably damaging	1.00
Z1176:Ttll7	UTSW	3	146915771	missense	probably damaging	1.00
Z1176:Ttll7	UTSW	3	146930178	missense	probably benign	0.01
Z1176:Ttll7	UTSW	3	146947635	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGACGGGCAGAATGTATGTG -3'
(R):5'- AGTTGCTGTTAAAAGGTTCACACC -3'

Sequencing Primer
(F):5'- GGATGCCATCAGAAGTTTTC -3'
(R):5'- TCGGTGACAGAACACTTGCCTAG -3'

Posted On

2014-09-18