Incidental Mutation 'R2144:4930553M12Rik'
ID 236590
Institutional Source Beutler Lab
Gene Symbol 4930553M12Rik
Ensembl Gene ENSMUSG00000054351
Gene Name RIKEN cDNA 4930553M12 gene
Synonyms
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 88867882-88868379 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88868174 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 69 (T69I)
Ref Sequence ENSEMBL: ENSMUSP00000052657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057837]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000057837
AA Change: T69I
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,341,778 (GRCm38) Q485L probably damaging Het
Adam5 C A 8: 24,815,480 (GRCm38) V81F probably benign Het
Armc4 C T 18: 7,127,229 (GRCm38) E995K probably damaging Het
Atp5s A G 12: 69,741,054 (GRCm38) Q88R probably damaging Het
Bag2 A G 1: 33,746,831 (GRCm38) S137P possibly damaging Het
Birc6 A T 17: 74,660,413 (GRCm38) Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 (GRCm38) F999L probably benign Het
Cap2 A T 13: 46,560,502 (GRCm38) probably null Het
Ccnk T A 12: 108,189,090 (GRCm38) L102Q probably null Het
Cd52 T C 4: 134,093,737 (GRCm38) probably benign Het
Cdc123 A T 2: 5,810,806 (GRCm38) I160K probably benign Het
Cep85l T C 10: 53,358,126 (GRCm38) N52S probably benign Het
Cntnap5a C T 1: 116,101,710 (GRCm38) T298I probably benign Het
Cpsf4 G T 5: 145,178,762 (GRCm38) S192I probably benign Het
Cpxm1 A G 2: 130,397,410 (GRCm38) S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 (GRCm38) T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 (GRCm38) F137S probably damaging Het
Des A G 1: 75,366,804 (GRCm38) T444A probably benign Het
Dgcr8 C T 16: 18,284,256 (GRCm38) G54D probably damaging Het
Doxl2 A G 6: 48,975,291 (GRCm38) H50R probably benign Het
Dsc3 A G 18: 19,980,686 (GRCm38) F393S possibly damaging Het
Dstyk T A 1: 132,463,375 (GRCm38) M838K probably damaging Het
Dvl1 G A 4: 155,847,816 (GRCm38) V28I possibly damaging Het
Eml5 A C 12: 98,810,605 (GRCm38) F1417C probably damaging Het
Ep400 A T 5: 110,703,518 (GRCm38) M1366K unknown Het
Epg5 G T 18: 77,954,197 (GRCm38) C425F possibly damaging Het
Epha3 C G 16: 63,773,317 (GRCm38) R136P possibly damaging Het
Extl1 C A 4: 134,371,044 (GRCm38) E225D probably benign Het
Fam186b A G 15: 99,280,657 (GRCm38) Y263H probably benign Het
Fbn2 A G 18: 58,052,993 (GRCm38) V1761A possibly damaging Het
Fer1l6 T A 15: 58,627,534 (GRCm38) M1251K probably benign Het
Gart A T 16: 91,630,081 (GRCm38) I555N probably damaging Het
Gm11596 A T 11: 99,792,963 (GRCm38) C110* probably null Het
Gnptab C T 10: 88,428,506 (GRCm38) S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 (GRCm38) V263A probably benign Het
Gxylt1 T C 15: 93,254,480 (GRCm38) I224V probably benign Het
H2-Aa A G 17: 34,283,827 (GRCm38) S122P probably damaging Het
Hsph1 A C 5: 149,630,337 (GRCm38) probably null Het
Hunk G A 16: 90,432,532 (GRCm38) D94N probably damaging Het
Ikbke C A 1: 131,273,474 (GRCm38) V176L probably damaging Het
Inpp5k A T 11: 75,647,191 (GRCm38) probably null Het
Ints10 A G 8: 68,796,805 (GRCm38) T96A probably damaging Het
Kansl2 A T 15: 98,526,631 (GRCm38) V306E probably benign Het
Kif20a A G 18: 34,625,604 (GRCm38) D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 (GRCm38) M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 (GRCm38) I50V probably benign Het
Ktn1 A G 14: 47,714,652 (GRCm38) E983G probably damaging Het
Lrrk1 G A 7: 66,296,163 (GRCm38) S566L probably damaging Het
M6pr A G 6: 122,315,367 (GRCm38) M174V probably benign Het
Man2a2 A G 7: 80,363,516 (GRCm38) S510P probably damaging Het
Mmrn1 G A 6: 60,945,075 (GRCm38) S172N possibly damaging Het
Mpv17 A G 5: 31,154,189 (GRCm38) probably null Het
Mrgpra9 T C 7: 47,235,463 (GRCm38) E152G probably benign Het
Mst1r T C 9: 107,913,168 (GRCm38) V660A probably benign Het
Myof A G 19: 37,981,221 (GRCm38) probably null Het
Myrf G A 19: 10,228,674 (GRCm38) P126L probably benign Het
Nckap1l C T 15: 103,475,676 (GRCm38) A567V probably damaging Het
Nphs1 A G 7: 30,460,970 (GRCm38) E169G probably benign Het
Npy1r T A 8: 66,705,184 (GRCm38) V382D probably benign Het
Nrl A T 14: 55,520,850 (GRCm38) M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 (GRCm38) I144T probably damaging Het
Olfr199 C T 16: 59,216,026 (GRCm38) V196M probably benign Het
Olfr292 T A 7: 86,695,280 (GRCm38) F275I probably damaging Het
Olfr694 A T 7: 106,688,957 (GRCm38) M258K probably damaging Het
Olfr924 C T 9: 38,848,339 (GRCm38) T75I probably damaging Het
Orc5 T A 5: 22,547,927 (GRCm38) L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 (GRCm38) S396T probably benign Het
Pappa T A 4: 65,180,949 (GRCm38) Y568* probably null Het
Pask C T 1: 93,321,297 (GRCm38) A794T probably benign Het
Pclo C T 5: 14,858,752 (GRCm38) L5025F unknown Het
Pde3a T C 6: 141,490,111 (GRCm38) V924A probably benign Het
Pdpr A G 8: 111,118,036 (GRCm38) N355S probably damaging Het
Pepd A T 7: 34,921,418 (GRCm38) K36M probably benign Het
Pet100 T G 8: 3,622,355 (GRCm38) L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 (GRCm38) T438A probably benign Het
Pik3r6 T A 11: 68,543,611 (GRCm38) L546* probably null Het
Pira2 A T 7: 3,844,345 (GRCm38) L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 (GRCm38) Y339C probably damaging Het
Primpol A T 8: 46,586,343 (GRCm38) M414K probably damaging Het
Prol1 A T 5: 88,328,395 (GRCm38) T215S unknown Het
Prss22 A G 17: 23,994,682 (GRCm38) Y212H probably damaging Het
Ralgapa2 C A 2: 146,388,604 (GRCm38) V1014L probably damaging Het
Rap1gap2 G A 11: 74,425,976 (GRCm38) T245M probably damaging Het
Rbm26 T A 14: 105,115,202 (GRCm38) R1009* probably null Het
Rbm42 A G 7: 30,641,110 (GRCm38) *450Q probably null Het
Rere T C 4: 150,616,931 (GRCm38) V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 (GRCm38) L15F probably damaging Het
Rnf213 T C 11: 119,443,690 (GRCm38) S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 (GRCm38) V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 (GRCm38) probably benign Het
Sin3b T C 8: 72,731,265 (GRCm38) L203P probably damaging Het
Skint6 T C 4: 113,236,260 (GRCm38) S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 (GRCm38) Y566C probably damaging Het
Smgc T G 15: 91,844,421 (GRCm38) D121E possibly damaging Het
Sned1 T A 1: 93,271,684 (GRCm38) F495L probably damaging Het
St7 A T 6: 17,886,007 (GRCm38) N52I possibly damaging Het
Sycn C A 7: 28,541,069 (GRCm38) Q54K probably benign Het
Syngr4 A G 7: 45,887,040 (GRCm38) V186A probably benign Het
Tarsl2 G A 7: 65,655,791 (GRCm38) M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 (GRCm38) H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 (GRCm38) Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 (GRCm38) Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 (GRCm38) G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 (GRCm38) V23G possibly damaging Het
Trhr T C 15: 44,197,183 (GRCm38) V33A probably benign Het
Trim66 A T 7: 109,475,113 (GRCm38) I647N probably damaging Het
Trnt1 A G 6: 106,778,039 (GRCm38) K244E probably damaging Het
Tsfm G A 10: 127,028,445 (GRCm38) Q134* probably null Het
Ttll9 A G 2: 153,003,007 (GRCm38) T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 (GRCm38) L623F probably damaging Het
Wdr55 A G 18: 36,762,366 (GRCm38) N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 (GRCm38) R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 (GRCm38) probably benign Het
Zfp260 A G 7: 30,105,340 (GRCm38) K222E probably damaging Het
Zfp300 A G X: 21,081,951 (GRCm38) S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 (GRCm38) T959A probably benign Het
Other mutations in 4930553M12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:4930553M12Rik APN 4 88,868,073 (GRCm38) nonsense probably null
R0194:4930553M12Rik UTSW 4 88,868,243 (GRCm38) missense unknown
R2143:4930553M12Rik UTSW 4 88,868,175 (GRCm38) missense unknown
R2143:4930553M12Rik UTSW 4 88,868,174 (GRCm38) missense unknown
R2144:4930553M12Rik UTSW 4 88,868,175 (GRCm38) missense unknown
R5135:4930553M12Rik UTSW 4 88,868,271 (GRCm38) missense unknown
R5822:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R5848:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R5849:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R5850:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R5854:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R5856:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R6128:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R6130:4930553M12Rik UTSW 4 88,868,359 (GRCm38) missense unknown
R7054:4930553M12Rik UTSW 4 88,868,249 (GRCm38) missense unknown
R7292:4930553M12Rik UTSW 4 88,868,331 (GRCm38) missense unknown
R7754:4930553M12Rik UTSW 4 88,868,259 (GRCm38) missense unknown
R7844:4930553M12Rik UTSW 4 88,868,186 (GRCm38) missense unknown
R7980:4930553M12Rik UTSW 4 88,868,078 (GRCm38) missense unknown
R9417:4930553M12Rik UTSW 4 88,867,965 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- TTGTTGAAGCTGGAACCGCG -3'
(R):5'- TGTAGCGGGTCATTCCTTCC -3'

Sequencing Primer
(F):5'- CGTGAAAGCCTGGGTTAAACTCTG -3'
(R):5'- ATACCACTCTCAGCAGTTGC -3'
Posted On 2014-10-01