Mutagenetix > Incidental Mutation

Incidental Mutation 'R2144:Rnf213'

236663

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

040147-MU

Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2144 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119443690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 3242 (S3242P)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093902
AA Change: S3243P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: S3243P

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: S3242P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: S3242P

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	G	A	4: 88,868,174	T69I	unknown	Het
4930553M12Rik	T	A	4: 88,868,175	T69S	unknown	Het
Acsl6	A	T	11: 54,341,778	Q485L	probably damaging	Het
Adam5	C	A	8: 24,815,480	V81F	probably benign	Het
Armc4	C	T	18: 7,127,229	E995K	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Cap2	A	T	13: 46,560,502		probably null	Het
Ccnk	T	A	12: 108,189,090	L102Q	probably null	Het
Cd52	T	C	4: 134,093,737		probably benign	Het
Cdc123	A	T	2: 5,810,806	I160K	probably benign	Het
Cep85l	T	C	10: 53,358,126	N52S	probably benign	Het
Cntnap5a	C	T	1: 116,101,710	T298I	probably benign	Het
Cpsf4	G	T	5: 145,178,762	S192I	probably benign	Het
Cpxm1	A	G	2: 130,397,410	S33P	probably benign	Het
Cyp2a12	A	T	7: 27,034,769	T376S	possibly damaging	Het
Cyp3a16	A	G	5: 145,456,084	F137S	probably damaging	Het
Des	A	G	1: 75,366,804	T444A	probably benign	Het
Dgcr8	C	T	16: 18,284,256	G54D	probably damaging	Het
Doxl2	A	G	6: 48,975,291	H50R	probably benign	Het
Dsc3	A	G	18: 19,980,686	F393S	possibly damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Eml5	A	C	12: 98,810,605	F1417C	probably damaging	Het
Ep400	A	T	5: 110,703,518	M1366K	unknown	Het
Epg5	G	T	18: 77,954,197	C425F	possibly damaging	Het
Epha3	C	G	16: 63,773,317	R136P	possibly damaging	Het
Extl1	C	A	4: 134,371,044	E225D	probably benign	Het
Fam186b	A	G	15: 99,280,657	Y263H	probably benign	Het
Fbn2	A	G	18: 58,052,993	V1761A	possibly damaging	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Gart	A	T	16: 91,630,081	I555N	probably damaging	Het
Gm11596	A	T	11: 99,792,963	C110*	probably null	Het
Gnptab	C	T	10: 88,428,506	S262L	possibly damaging	Het
Gpr21	T	C	2: 37,518,231	V263A	probably benign	Het
Gxylt1	T	C	15: 93,254,480	I224V	probably benign	Het
H2-Aa	A	G	17: 34,283,827	S122P	probably damaging	Het
Hsph1	A	C	5: 149,630,337		probably null	Het
Hunk	G	A	16: 90,432,532	D94N	probably damaging	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Ints10	A	G	8: 68,796,805	T96A	probably damaging	Het
Kansl2	A	T	15: 98,526,631	V306E	probably benign	Het
Kif20a	A	G	18: 34,625,604	D42G	possibly damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Krtap1-5	T	C	11: 99,580,818	I50V	probably benign	Het
Ktn1	A	G	14: 47,714,652	E983G	probably damaging	Het
Lrrk1	G	A	7: 66,296,163	S566L	probably damaging	Het
M6pr	A	G	6: 122,315,367	M174V	probably benign	Het
Man2a2	A	G	7: 80,363,516	S510P	probably damaging	Het
Mmrn1	G	A	6: 60,945,075	S172N	possibly damaging	Het
Mpv17	A	G	5: 31,154,189		probably null	Het
Mrgpra9	T	C	7: 47,235,463	E152G	probably benign	Het
Mst1r	T	C	9: 107,913,168	V660A	probably benign	Het
Myof	A	G	19: 37,981,221		probably null	Het
Myrf	G	A	19: 10,228,674	P126L	probably benign	Het
Nckap1l	C	T	15: 103,475,676	A567V	probably damaging	Het
Nphs1	A	G	7: 30,460,970	E169G	probably benign	Het
Npy1r	T	A	8: 66,705,184	V382D	probably benign	Het
Nrl	A	T	14: 55,520,850	M140K	possibly damaging	Het
Olfr1305	A	G	2: 111,873,423	I144T	probably damaging	Het
Olfr199	C	T	16: 59,216,026	V196M	probably benign	Het
Olfr292	T	A	7: 86,695,280	F275I	probably damaging	Het
Olfr694	A	T	7: 106,688,957	M258K	probably damaging	Het
Olfr924	C	T	9: 38,848,339	T75I	probably damaging	Het
Orc5	T	A	5: 22,547,927	L36F	possibly damaging	Het
Osbpl1a	A	T	18: 12,871,173	S396T	probably benign	Het
Pappa	T	A	4: 65,180,949	Y568*	probably null	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pclo	C	T	5: 14,858,752	L5025F	unknown	Het
Pde3a	T	C	6: 141,490,111	V924A	probably benign	Het
Pdpr	A	G	8: 111,118,036	N355S	probably damaging	Het
Pepd	A	T	7: 34,921,418	K36M	probably benign	Het
Pet100	T	G	8: 3,622,355	L14R	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Pik3r6	T	A	11: 68,543,611	L546*	probably null	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Primpol	A	T	8: 46,586,343	M414K	probably damaging	Het
Prol1	A	T	5: 88,328,395	T215S	unknown	Het
Prss22	A	G	17: 23,994,682	Y212H	probably damaging	Het
Ralgapa2	C	A	2: 146,388,604	V1014L	probably damaging	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rbm26	T	A	14: 105,115,202	R1009*	probably null	Het
Rbm42	A	G	7: 30,641,110	*450Q	probably null	Het
Rere	T	C	4: 150,616,931	V1256A	probably damaging	Het
Rmi1	G	T	13: 58,407,983	L15F	probably damaging	Het
Rtel1	T	A	2: 181,323,706	V167E	probably damaging	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Sin3b	T	C	8: 72,731,265	L203P	probably damaging	Het
Skint6	T	C	4: 113,236,260	S229G	possibly damaging	Het
Slco1a4	T	C	6: 141,809,378	Y566C	probably damaging	Het
Smgc	T	G	15: 91,844,421	D121E	possibly damaging	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
St7	A	T	6: 17,886,007	N52I	possibly damaging	Het
Sycn	C	A	7: 28,541,069	Q54K	probably benign	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tcaf2	A	T	6: 42,642,804	H96Q	probably benign	Het
Tcp11l2	T	C	10: 84,613,499	Y443H	probably damaging	Het
Tmem200c	A	T	17: 68,842,249	Q609L	possibly damaging	Het
Tmx3	G	A	18: 90,517,490	G83R	probably damaging	Het
Tpgs2	A	C	18: 25,168,541	V23G	possibly damaging	Het
Trhr	T	C	15: 44,197,183	V33A	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Trnt1	A	G	6: 106,778,039	K244E	probably damaging	Het
Tsfm	G	A	10: 127,028,445	Q134*	probably null	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vmn2r78	C	T	7: 86,954,482	L623F	probably damaging	Het
Wdr55	A	G	18: 36,762,366	N132S	possibly damaging	Het
Wipf2	A	T	11: 98,896,214	R356S	possibly damaging	Het
Wnk1	A	G	6: 119,948,988		probably benign	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp592	A	G	7: 81,038,202	T959A	probably benign	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119449343	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119440843	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119447237	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119483118	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119443300	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119449876	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119436352	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119441307	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119442266	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119443015	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119416457	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119443268	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119418309	splice site	probably benign
IGL02084:Rnf213	APN	11	119445673	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119440650	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119480907	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119463336	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119436802	missense	probably benign
IGL02588:Rnf213	APN	11	119416536	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119440789	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119435066	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119427510	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119479941	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119445626	splice site	probably benign
IGL03057:Rnf213	APN	11	119441087	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119465007	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119474172	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119443004	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119421468	missense	probably benign	0.34
attrition	UTSW	11	119430321	missense	possibly damaging	0.77
defame	UTSW	11	119430281	nonsense	probably null
Derogate	UTSW	11	119470210	missense	probably damaging	1.00
dinky	UTSW	11	119416458	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119434742	missense
Impugn	UTSW	11	119436823	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119436676	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119426069	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119434742	missense
PIT4585001:Rnf213	UTSW	11	119458392	missense
R0008:Rnf213	UTSW	11	119465052	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119441606	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119402575	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119414587	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119416496	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119479600	nonsense	probably null
R0184:Rnf213	UTSW	11	119414521	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119438105	nonsense	probably null
R0365:Rnf213	UTSW	11	119426111	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119447257	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119426012	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119443120	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119465082	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119443280	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119431717	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119470210	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119441834	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119441150	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119441068	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119473480	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119423095	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119430486	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119414570	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119416563	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119452581	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119485998	splice site	probably benign
R1104:Rnf213	UTSW	11	119477229	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119435983	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119436177	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119436005	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119442400	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119437750	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119480889	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119441888	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119442707	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119441839	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119414526	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119436611	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119463345	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119442579	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119437672	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119440221	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119441183	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119450129	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119416448	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119431685	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119480895	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119441107	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119436022	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119461918	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119467302	nonsense	probably null
R2109:Rnf213	UTSW	11	119442663	nonsense	probably null
R2115:Rnf213	UTSW	11	119428013	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119450201	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119415193	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119415070	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119460009	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119436428	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119414604	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119443195	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119459938	splice site	probably null
R2698:Rnf213	UTSW	11	119410144	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119468892	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119441976	nonsense	probably null
R3808:Rnf213	UTSW	11	119479558	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119480939	splice site	probably benign
R3856:Rnf213	UTSW	11	119480939	splice site	probably benign
R3973:Rnf213	UTSW	11	119469053	missense
R4014:Rnf213	UTSW	11	119445729	nonsense	probably null
R4049:Rnf213	UTSW	11	119482448	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119483006	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119409482	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119441243	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119436823	nonsense	probably null
R4332:Rnf213	UTSW	11	119436676	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119483964	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119479670	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119437695	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119441125	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119440349	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119445745	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119416629	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119442763	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119481240	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119428157	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119436764	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119410807	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119458866	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119440816	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119440808	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119409020	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119415076	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119433499	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119436629	missense	probably benign	0.04
R5636:Rnf213	UTSW	11	119436905	missense	probably damaging	1.00
R5669:Rnf213	UTSW	11	119458785	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119434686	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119483894	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119416458	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119436295	missense	probably benign
R5861:Rnf213	UTSW	11	119473377	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119421369	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119443079	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119486010	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119442101	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119416559	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119411513	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119411470	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119442028	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119435999	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119458428	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119414548	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119463366	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119477078	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119459966	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119452687	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119436280	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119479920	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119430321	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119442271	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119442236	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119462285	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119448838	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119449866	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119479655	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119437604	splice site	probably null
R7170:Rnf213	UTSW	11	119452575	missense
R7185:Rnf213	UTSW	11	119424198	missense
R7239:Rnf213	UTSW	11	119458788	missense
R7258:Rnf213	UTSW	11	119452575	missense
R7259:Rnf213	UTSW	11	119452575	missense
R7260:Rnf213	UTSW	11	119452575	missense
R7273:Rnf213	UTSW	11	119431756	splice site	probably null
R7282:Rnf213	UTSW	11	119437992	missense
R7311:Rnf213	UTSW	11	119416547	missense
R7352:Rnf213	UTSW	11	119443579	missense
R7369:Rnf213	UTSW	11	119430468	missense
R7410:Rnf213	UTSW	11	119435051	missense
R7448:Rnf213	UTSW	11	119481291	missense
R7561:Rnf213	UTSW	11	119441719	missense
R7573:Rnf213	UTSW	11	119458484	missense
R7615:Rnf213	UTSW	11	119467297	missense
R7680:Rnf213	UTSW	11	119479556	missense
R7739:Rnf213	UTSW	11	119410861	missense
R7789:Rnf213	UTSW	11	119470219	splice site	probably null
R7806:Rnf213	UTSW	11	119411545	missense
R8031:Rnf213	UTSW	11	119430281	nonsense	probably null
R8042:Rnf213	UTSW	11	119441654	missense
R8053:Rnf213	UTSW	11	119402647	missense
R8284:Rnf213	UTSW	11	119428083	missense
R8301:Rnf213	UTSW	11	119434742	missense
R8325:Rnf213	UTSW	11	119430445	missense
R8332:Rnf213	UTSW	11	119483698	missense
R8443:Rnf213	UTSW	11	119449323	missense
R8518:Rnf213	UTSW	11	119462217	missense
R8531:Rnf213	UTSW	11	119474205	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119458737	missense
R8675:Rnf213	UTSW	11	119456158	missense
R8690:Rnf213	UTSW	11	119418129	missense
R8690:Rnf213	UTSW	11	119441212	missense
R8714:Rnf213	UTSW	11	119468894	missense
R8802:Rnf213	UTSW	11	119462102	missense
R8861:Rnf213	UTSW	11	119442236	missense
R8886:Rnf213	UTSW	11	119473438	missense
R8893:Rnf213	UTSW	11	119443042	missense
R8937:Rnf213	UTSW	11	119430274	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119414424	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119461930	missense
R8983:Rnf213	UTSW	11	119430349	missense
R9043:Rnf213	UTSW	11	119458913	missense
R9081:Rnf213	UTSW	11	119466236	missense
R9132:Rnf213	UTSW	11	119483916	missense
R9135:Rnf213	UTSW	11	119408747	missense
R9146:Rnf213	UTSW	11	119443673	missense
R9156:Rnf213	UTSW	11	119440748	missense
R9183:Rnf213	UTSW	11	119427622	missense
R9234:Rnf213	UTSW	11	119450117	missense
R9275:Rnf213	UTSW	11	119435942	missense
R9278:Rnf213	UTSW	11	119435942	missense
R9296:Rnf213	UTSW	11	119443795	splice site	probably benign
R9350:Rnf213	UTSW	11	119442149	missense
R9366:Rnf213	UTSW	11	119436231	missense
R9413:Rnf213	UTSW	11	119466233	missense
R9444:Rnf213	UTSW	11	119434797	missense
R9464:Rnf213	UTSW	11	119463580	missense
R9605:Rnf213	UTSW	11	119469053	missense
R9649:Rnf213	UTSW	11	119479631	missense
R9651:Rnf213	UTSW	11	119440412	missense
R9664:Rnf213	UTSW	11	119441968	missense
R9696:Rnf213	UTSW	11	119468980	missense
R9710:Rnf213	UTSW	11	119441005	missense
R9797:Rnf213	UTSW	11	119442539	missense
S24628:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119441824	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119473513	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119440463	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119477254	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119441410	missense
Z1176:Rnf213	UTSW	11	119482998	missense

Predicted Primers

PCR Primer
(F):5'- GGCTACCATTCAGATGCCTGTG -3'
(R):5'- TAAGTCACCCCTGCATGCTG -3'

Sequencing Primer
(F):5'- AGATGCCTGTGCCTCTGTG -3'
(R):5'- ATACAGCTGGAGTTTCTGACCCTAG -3'

Posted On

2014-10-01