Mutagenetix > Incidental Mutations

Incidental Mutation 'R2232:Dgkd'

240075

Institutional Source

Beutler Lab

Gene Symbol

Dgkd

Ensembl Gene

ENSMUSG00000070738

Gene Name

diacylglycerol kinase, delta

Synonyms

dgkd-2, DGKdelta, AI841987, D330025K09

MMRRC Submission

040233-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.720) question?

Stock #

R2232 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87853287-87945180 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87929742 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 725 (S725R)

Ref Sequence

ENSEMBL: ENSMUSP00000027517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000190061]

Predicted Effect

probably benign
Transcript: ENSMUST00000027517
AA Change: S725R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: S725R

Domain	Start	End	E-Value	Type
low complexity region	2	36	N/A	INTRINSIC
PH	54	148	1.7e-16	SMART
C1	164	213	2.48e-15	SMART
low complexity region	221	232	N/A	INTRINSIC
C1	236	286	8.56e-10	SMART
DAGKc	321	446	9.44e-62	SMART
low complexity region	691	710	N/A	INTRINSIC
DAGKa	765	922	1.25e-98	SMART
low complexity region	1128	1139	N/A	INTRINSIC
SAM	1148	1214	2.16e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185260

Predicted Effect

probably benign
Transcript: ENSMUST00000190061

SMART Domains

Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738

Domain	Start	End	E-Value	Type
DAGKa	1	95	7.6e-26	SMART
Blast:DAGKa	119	188	1e-23	BLAST
low complexity region	301	312	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	A	8: 36,512,553	C437S	probably damaging	Het
Adam1a	A	C	5: 121,519,732	D499E	possibly damaging	Het
Adamtsl2	G	A	2: 27,103,178	G740E	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Akap9	G	A	5: 4,046,603	V2493I	probably damaging	Het
Ankra2	T	C	13: 98,271,138	F199L	probably damaging	Het
Ankrd63	A	G	2: 118,703,365		probably benign	Het
Asns	A	G	6: 7,689,316	I62T	possibly damaging	Het
BC027072	A	G	17: 71,749,284	S1133P	probably benign	Het
Celf3	T	A	3: 94,480,259		probably null	Het
Cyp4f37	A	G	17: 32,634,270	T403A	probably benign	Het
Dnah5	G	A	15: 28,408,417		probably null	Het
Ergic3	A	G	2: 156,017,816	T346A	probably damaging	Het
Fam189a1	G	A	7: 64,759,222	H475Y	probably damaging	Het
Fam227a	T	A	15: 79,615,381	Y591F	possibly damaging	Het
Gal3st1	T	C	11: 3,998,282	I163T	probably benign	Het
Ghrhr	T	C	6: 55,385,459	F347S	probably damaging	Het
Htr2a	A	T	14: 74,645,029	I152F	probably damaging	Het
Il17re	T	C	6: 113,464,800	C219R	probably damaging	Het
Kansl2	A	G	15: 98,524,478	L403S	probably damaging	Het
Kif21a	G	A	15: 90,985,362	Q429*	probably null	Het
L1cam	T	A	X: 73,861,341	N503I	possibly damaging	Het
Lrrk2	A	G	15: 91,764,716	K1638E	probably benign	Het
Mcpt9	A	T	14: 56,027,988	C85S	probably benign	Het
Mindy3	C	A	2: 12,404,045	R73M	probably benign	Het
Mrgprb3	T	C	7: 48,643,022	I260M	probably benign	Het
Nes	T	A	3: 87,978,931	I1499N	possibly damaging	Het
Ninl	A	G	2: 150,950,050	V851A	probably benign	Het
Oaz3	T	C	3: 94,434,539	T130A	probably benign	Het
Olfr140	A	T	2: 90,052,225	F33Y	probably benign	Het
Olfr1406	A	G	1: 173,183,615	I273T	probably benign	Het
Pacs2	G	A	12: 113,063,367	D605N	probably damaging	Het
Pdk3	G	T	X: 93,813,998	N59K	probably damaging	Het
Pigq	T	C	17: 25,932,209	H322R	probably benign	Het
Ppp3r1	G	A	11: 17,193,115	G68R	probably damaging	Het
Proz	A	G	8: 13,063,356	Y59C	probably damaging	Het
Prpf39	C	T	12: 65,044,012	R32*	probably null	Het
Prr5	T	C	15: 84,702,780	S244P	probably benign	Het
Pth2r	G	T	1: 65,336,769	W62L	probably damaging	Het
Scin	T	A	12: 40,068,931	K622I	probably damaging	Het
Serpinb6a	T	C	13: 33,925,320	K143R	probably damaging	Het
Ska1	G	T	18: 74,197,066		probably null	Het
Slc30a8	G	T	15: 52,306,564	R62S	probably benign	Het
Slc8a3	A	C	12: 81,315,220	I275S	probably damaging	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Sspo	A	G	6: 48,448,672	I76V	probably damaging	Het
St5	T	C	7: 109,557,207	D112G	probably benign	Het
Sult1c2	G	T	17: 53,831,820	T243K	probably benign	Het
Svil	T	A	18: 5,046,640	M1K	probably null	Het
Tet3	T	C	6: 83,369,471	D1328G	probably damaging	Het
Thegl	A	G	5: 77,059,405	I337V	possibly damaging	Het
Tnfsf14	T	C	17: 57,193,876	D65G	probably benign	Het
Ttc3	T	C	16: 94,459,972	S1439P	probably benign	Het
Ttn	A	T	2: 76,944,153	F2136L	probably damaging	Het
Usb1	T	G	8: 95,344,046	L200R	probably damaging	Het
Usp20	A	G	2: 31,018,738	N777S	probably benign	Het
Zfp92	G	T	X: 73,422,752	L450F	possibly damaging	Het

Other mutations in Dgkd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01529:Dgkd	APN	1	87880411	missense	probably damaging	1.00
IGL01531:Dgkd	APN	1	87880411	missense	probably damaging	1.00
IGL01627:Dgkd	APN	1	87880428	missense	probably damaging	1.00
IGL01720:Dgkd	APN	1	87936765	missense	probably damaging	1.00
IGL01915:Dgkd	APN	1	87926058	missense	possibly damaging	0.86
IGL01941:Dgkd	APN	1	87924559	missense	probably damaging	0.99
IGL01951:Dgkd	APN	1	87916916	missense	probably damaging	1.00
IGL02244:Dgkd	APN	1	87915141	missense	probably benign	0.27
IGL02581:Dgkd	APN	1	87918002	splice site	probably benign
IGL02852:Dgkd	APN	1	87935413	missense	probably damaging	1.00
IGL02893:Dgkd	APN	1	87915208	splice site	probably benign
IGL03367:Dgkd	APN	1	87940308	critical splice donor site	probably null
R0014:Dgkd	UTSW	1	87881881	missense	probably damaging	1.00
R0016:Dgkd	UTSW	1	87917952	missense	probably benign	0.02
R0219:Dgkd	UTSW	1	87938274	splice site	probably benign
R0496:Dgkd	UTSW	1	87936900	missense	probably null	0.83
R0559:Dgkd	UTSW	1	87915104	missense	probably damaging	1.00
R0591:Dgkd	UTSW	1	87915104	missense	probably damaging	1.00
R1270:Dgkd	UTSW	1	87934125	missense	probably damaging	0.96
R1599:Dgkd	UTSW	1	87881886	missense	possibly damaging	0.58
R1658:Dgkd	UTSW	1	87926268	missense	probably damaging	1.00
R1745:Dgkd	UTSW	1	87932044	critical splice donor site	probably null
R1959:Dgkd	UTSW	1	87929827	missense	possibly damaging	0.47
R1960:Dgkd	UTSW	1	87929827	missense	possibly damaging	0.47
R2044:Dgkd	UTSW	1	87927691	missense	probably benign
R2148:Dgkd	UTSW	1	87881921	missense	probably damaging	1.00
R2266:Dgkd	UTSW	1	87927818	unclassified	probably benign
R3774:Dgkd	UTSW	1	87936300	missense	probably damaging	1.00
R4004:Dgkd	UTSW	1	87935423	missense	possibly damaging	0.56
R4005:Dgkd	UTSW	1	87935423	missense	possibly damaging	0.56
R4133:Dgkd	UTSW	1	87941501	critical splice donor site	probably null
R4235:Dgkd	UTSW	1	87931982	nonsense	probably null
R4644:Dgkd	UTSW	1	87936294	missense	probably damaging	1.00
R4747:Dgkd	UTSW	1	87934167	missense	probably damaging	1.00
R4864:Dgkd	UTSW	1	87916838	missense	possibly damaging	0.94
R5334:Dgkd	UTSW	1	87938267	critical splice donor site	probably null
R5365:Dgkd	UTSW	1	87935416	missense	probably damaging	1.00
R5495:Dgkd	UTSW	1	87926872	missense	probably damaging	1.00
R5514:Dgkd	UTSW	1	87934110	missense	probably damaging	1.00
R5729:Dgkd	UTSW	1	87936332	nonsense	probably null
R5766:Dgkd	UTSW	1	87880449	nonsense	probably null
R6133:Dgkd	UTSW	1	87938240	missense	possibly damaging	0.93
R6137:Dgkd	UTSW	1	87936381	missense	possibly damaging	0.48
R6198:Dgkd	UTSW	1	87924208	missense	probably damaging	1.00
R6297:Dgkd	UTSW	1	87926144	missense	possibly damaging	0.94
R6577:Dgkd	UTSW	1	87940240	missense	probably damaging	1.00
R6846:Dgkd	UTSW	1	87925691	splice site	probably null
R6905:Dgkd	UTSW	1	87935375	missense	probably damaging	1.00
R7369:Dgkd	UTSW	1	87921622	missense	probably damaging	1.00
R7763:Dgkd	UTSW	1	87926949	missense	probably benign
R7921:Dgkd	UTSW	1	87924084	missense	probably damaging	0.98
R8087:Dgkd	UTSW	1	87916847	missense	probably damaging	1.00
R8119:Dgkd	UTSW	1	87917967	missense	possibly damaging	0.78
R8731:Dgkd	UTSW	1	87916813	missense	not run
Z1176:Dgkd	UTSW	1	87927810	missense	probably benign	0.05
Z1177:Dgkd	UTSW	1	87916886	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCATGTAATGTACAGATAATGCCAG -3'
(R):5'- CACTGATGGCTCTGATTGTGAATC -3'

Sequencing Primer
(F):5'- ATGTACAGATAATGCCAGGTAAATG -3'
(R):5'- GATTGTGAATCAGACCTCTGCAC -3'

Posted On

2014-10-15