Mutagenetix > Incidental Mutation

Incidental Mutation 'R2232:Adamtsl2'

240079

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

040233-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2232 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27103178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 740 (G740E)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091233
AA Change: G740E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: G740E

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130600

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	A	8: 36,512,553	C437S	probably damaging	Het
Adam1a	A	C	5: 121,519,732	D499E	possibly damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Akap9	G	A	5: 4,046,603	V2493I	probably damaging	Het
Ankra2	T	C	13: 98,271,138	F199L	probably damaging	Het
Ankrd63	A	G	2: 118,703,365		probably benign	Het
Asns	A	G	6: 7,689,316	I62T	possibly damaging	Het
BC027072	A	G	17: 71,749,284	S1133P	probably benign	Het
Celf3	T	A	3: 94,480,259		probably null	Het
Cyp4f37	A	G	17: 32,634,270	T403A	probably benign	Het
Dgkd	T	A	1: 87,929,742	S725R	probably benign	Het
Dnah5	G	A	15: 28,408,417		probably null	Het
Ergic3	A	G	2: 156,017,816	T346A	probably damaging	Het
Fam189a1	G	A	7: 64,759,222	H475Y	probably damaging	Het
Fam227a	T	A	15: 79,615,381	Y591F	possibly damaging	Het
Gal3st1	T	C	11: 3,998,282	I163T	probably benign	Het
Ghrhr	T	C	6: 55,385,459	F347S	probably damaging	Het
Htr2a	A	T	14: 74,645,029	I152F	probably damaging	Het
Il17re	T	C	6: 113,464,800	C219R	probably damaging	Het
Kansl2	A	G	15: 98,524,478	L403S	probably damaging	Het
Kif21a	G	A	15: 90,985,362	Q429*	probably null	Het
L1cam	T	A	X: 73,861,341	N503I	possibly damaging	Het
Lrrk2	A	G	15: 91,764,716	K1638E	probably benign	Het
Mcpt9	A	T	14: 56,027,988	C85S	probably benign	Het
Mindy3	C	A	2: 12,404,045	R73M	probably benign	Het
Mrgprb3	T	C	7: 48,643,022	I260M	probably benign	Het
Nes	T	A	3: 87,978,931	I1499N	possibly damaging	Het
Ninl	A	G	2: 150,950,050	V851A	probably benign	Het
Oaz3	T	C	3: 94,434,539	T130A	probably benign	Het
Olfr140	A	T	2: 90,052,225	F33Y	probably benign	Het
Olfr1406	A	G	1: 173,183,615	I273T	probably benign	Het
Pacs2	G	A	12: 113,063,367	D605N	probably damaging	Het
Pdk3	G	T	X: 93,813,998	N59K	probably damaging	Het
Pigq	T	C	17: 25,932,209	H322R	probably benign	Het
Ppp3r1	G	A	11: 17,193,115	G68R	probably damaging	Het
Proz	A	G	8: 13,063,356	Y59C	probably damaging	Het
Prpf39	C	T	12: 65,044,012	R32*	probably null	Het
Prr5	T	C	15: 84,702,780	S244P	probably benign	Het
Pth2r	G	T	1: 65,336,769	W62L	probably damaging	Het
Scin	T	A	12: 40,068,931	K622I	probably damaging	Het
Serpinb6a	T	C	13: 33,925,320	K143R	probably damaging	Het
Ska1	G	T	18: 74,197,066		probably null	Het
Slc30a8	G	T	15: 52,306,564	R62S	probably benign	Het
Slc8a3	A	C	12: 81,315,220	I275S	probably damaging	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Sspo	A	G	6: 48,448,672	I76V	probably damaging	Het
St5	T	C	7: 109,557,207	D112G	probably benign	Het
Sult1c2	G	T	17: 53,831,820	T243K	probably benign	Het
Svil	T	A	18: 5,046,640	M1K	probably null	Het
Tet3	T	C	6: 83,369,471	D1328G	probably damaging	Het
Thegl	A	G	5: 77,059,405	I337V	possibly damaging	Het
Tnfsf14	T	C	17: 57,193,876	D65G	probably benign	Het
Ttc3	T	C	16: 94,459,972	S1439P	probably benign	Het
Ttn	A	T	2: 76,944,153	F2136L	probably damaging	Het
Usb1	T	G	8: 95,344,046	L200R	probably damaging	Het
Usp20	A	G	2: 31,018,738	N777S	probably benign	Het
Zfp92	G	T	X: 73,422,752	L450F	possibly damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAGAGGTGAGCATCTACAGAC -3'
(R):5'- AGTCCCTACACGAGTGGAAG -3'

Sequencing Primer
(F):5'- ATCTACAGACGCTGGGGTG -3'
(R):5'- CGAGTGGAAGGGAGGTTATTATACTC -3'

Posted On

2014-10-15