Incidental Mutation 'R2232:Adamtsl2'
ID240079
Institutional Source Beutler Lab
Gene Symbol Adamtsl2
Ensembl Gene ENSMUSG00000036040
Gene NameADAMTS-like 2
SynonymsA930008K15Rik
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27079379-27108981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27103178 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 740 (G740E)
Ref Sequence ENSEMBL: ENSMUSP00000088774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233]
Predicted Effect probably damaging
Transcript: ENSMUST00000091233
AA Change: G740E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: G740E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169787
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Adamtsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Adamtsl2 APN 2 27085088 missense probably damaging 1.00
IGL01902:Adamtsl2 APN 2 27087252 missense probably damaging 1.00
IGL02207:Adamtsl2 APN 2 27102981 missense probably damaging 0.99
IGL02247:Adamtsl2 APN 2 27084893 missense probably damaging 1.00
IGL02253:Adamtsl2 APN 2 27098697 missense possibly damaging 0.48
IGL02655:Adamtsl2 APN 2 27082530 splice site probably benign
IGL03148:Adamtsl2 APN 2 27084059 missense probably damaging 0.99
IGL03269:Adamtsl2 APN 2 27108355 nonsense probably null
R0609:Adamtsl2 UTSW 2 27089635 missense probably benign 0.25
R1183:Adamtsl2 UTSW 2 27084080 missense probably damaging 1.00
R1443:Adamtsl2 UTSW 2 27103066 missense possibly damaging 0.89
R1675:Adamtsl2 UTSW 2 27082485 frame shift probably null
R1698:Adamtsl2 UTSW 2 27103127 missense possibly damaging 0.92
R1765:Adamtsl2 UTSW 2 27102830 missense probably benign 0.01
R1934:Adamtsl2 UTSW 2 27089593 missense probably damaging 0.99
R2106:Adamtsl2 UTSW 2 27102825 missense probably benign 0.02
R2108:Adamtsl2 UTSW 2 27095558 missense probably benign
R2189:Adamtsl2 UTSW 2 27081738 missense probably benign 0.00
R4301:Adamtsl2 UTSW 2 27087283 missense probably null 1.00
R4518:Adamtsl2 UTSW 2 27095547 missense probably benign 0.00
R4572:Adamtsl2 UTSW 2 27083256 missense probably damaging 0.99
R4627:Adamtsl2 UTSW 2 27093585 missense probably damaging 0.99
R4668:Adamtsl2 UTSW 2 27095475 missense probably benign 0.00
R4686:Adamtsl2 UTSW 2 27093825 missense probably damaging 0.99
R4821:Adamtsl2 UTSW 2 27098592 splice site probably null
R5054:Adamtsl2 UTSW 2 27101720 missense probably damaging 1.00
R5460:Adamtsl2 UTSW 2 27095398 splice site probably null
R5569:Adamtsl2 UTSW 2 27102833 missense probably damaging 1.00
R5694:Adamtsl2 UTSW 2 27081724 missense probably benign 0.03
R6836:Adamtsl2 UTSW 2 27081706 start codon destroyed probably null 0.90
R7103:Adamtsl2 UTSW 2 27107461 missense probably damaging 1.00
R7437:Adamtsl2 UTSW 2 27089709 missense probably damaging 0.99
X0003:Adamtsl2 UTSW 2 27081772 small deletion probably benign
X0003:Adamtsl2 UTSW 2 27081773 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGGTGAGCATCTACAGAC -3'
(R):5'- AGTCCCTACACGAGTGGAAG -3'

Sequencing Primer
(F):5'- ATCTACAGACGCTGGGGTG -3'
(R):5'- CGAGTGGAAGGGAGGTTATTATACTC -3'
Posted On2014-10-15