Incidental Mutation 'R3774:Dgkd'
ID 273479
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Name diacylglycerol kinase, delta
Synonyms dgkd-2, DGKdelta
Accession Numbers
Essential gene? Probably essential (E-score: 0.886) question?
Stock # R3774 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 87781009-87872902 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87864022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 79 (I79N)
Ref Sequence ENSEMBL: ENSMUSP00000139658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000189448] [ENSMUST00000190061]
AlphaFold E9PUQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000027517
AA Change: I906N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: I906N

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185260
AA Change: I94N
Predicted Effect probably benign
Transcript: ENSMUST00000189448
SMART Domains Protein: ENSMUSP00000139626
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 82 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189726
Predicted Effect probably damaging
Transcript: ENSMUST00000190061
AA Change: I79N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738
AA Change: I79N

DomainStartEndE-ValueType
DAGKa 1 95 7.6e-26 SMART
Blast:DAGKa 119 188 1e-23 BLAST
low complexity region 301 312 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,638,734 (GRCm39) V213A probably benign Het
Ccndbp1 A G 2: 120,839,581 (GRCm39) K26R possibly damaging Het
Chrna10 T C 7: 101,763,535 (GRCm39) T87A probably benign Het
Col27a1 T A 4: 63,232,963 (GRCm39) N360K probably benign Het
Crispld2 T C 8: 120,756,005 (GRCm39) S325P probably damaging Het
Dhdh T A 7: 45,131,362 (GRCm39) D157V probably benign Het
Dnajc15 A T 14: 78,094,377 (GRCm39) probably null Het
Fbxo44 G T 4: 148,241,051 (GRCm39) F179L probably damaging Het
Gm5565 T A 5: 146,095,419 (GRCm39) E192V probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Itgav A G 2: 83,622,308 (GRCm39) E630G probably damaging Het
Iws1 T C 18: 32,213,048 (GRCm39) S159P probably damaging Het
Kif23 G A 9: 61,832,274 (GRCm39) S623L probably benign Het
Krt32 A G 11: 99,978,947 (GRCm39) C36R probably benign Het
Med12l A C 3: 59,155,363 (GRCm39) Q1181P probably damaging Het
Megf10 G A 18: 57,410,177 (GRCm39) G653S probably damaging Het
Mon1a A G 9: 107,778,502 (GRCm39) Y242C probably damaging Het
Msh6 G T 17: 88,293,609 (GRCm39) R788L probably damaging Het
Mttp T C 3: 137,820,024 (GRCm39) probably null Het
Mxi1 C A 19: 53,360,160 (GRCm39) A294E probably benign Het
Olfm5 T A 7: 103,811,056 (GRCm39) R27S possibly damaging Het
Or52n2b T A 7: 104,566,113 (GRCm39) Y130F probably benign Het
Palmd T C 3: 116,721,312 (GRCm39) E81G probably damaging Het
Pecr A G 1: 72,298,530 (GRCm39) F297L probably benign Het
Phf11b A G 14: 59,563,506 (GRCm39) L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,320,921 (GRCm39) probably benign Het
Plcb4 A G 2: 135,800,065 (GRCm39) K472E probably benign Het
Pomgnt1 G A 4: 116,011,325 (GRCm39) R230H probably damaging Het
Pomt1 A G 2: 32,134,262 (GRCm39) H261R possibly damaging Het
Ppm1d T C 11: 85,227,993 (GRCm39) I303T probably damaging Het
Ptprc T G 1: 137,992,511 (GRCm39) Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 (GRCm39) T264I possibly damaging Het
Rfc1 T C 5: 65,421,749 (GRCm39) Y1050C probably damaging Het
Septin8 T C 11: 53,428,406 (GRCm39) V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 (GRCm39) Q358L probably damaging Het
Ssh1 T C 5: 114,104,783 (GRCm39) D12G probably damaging Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Tnik T C 3: 28,692,568 (GRCm39) Y820H probably damaging Het
Trpm3 T C 19: 22,955,966 (GRCm39) F1143L possibly damaging Het
Trpm3 T A 19: 22,965,339 (GRCm39) S1611R probably benign Het
Ttyh3 A G 5: 140,634,489 (GRCm39) F32L probably damaging Het
Unkl T A 17: 25,407,381 (GRCm39) probably null Het
Vwf T A 6: 125,626,062 (GRCm39) probably null Het
Wdr11 T A 7: 129,233,417 (GRCm39) probably null Het
Yeats2 A G 16: 19,969,245 (GRCm39) D12G probably damaging Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87,808,133 (GRCm39) missense probably damaging 1.00
IGL01531:Dgkd APN 1 87,808,133 (GRCm39) missense probably damaging 1.00
IGL01627:Dgkd APN 1 87,808,150 (GRCm39) missense probably damaging 1.00
IGL01720:Dgkd APN 1 87,864,487 (GRCm39) missense probably damaging 1.00
IGL01915:Dgkd APN 1 87,853,780 (GRCm39) missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87,852,281 (GRCm39) missense probably damaging 0.99
IGL01951:Dgkd APN 1 87,844,638 (GRCm39) missense probably damaging 1.00
IGL02244:Dgkd APN 1 87,842,863 (GRCm39) missense probably benign 0.27
IGL02581:Dgkd APN 1 87,845,724 (GRCm39) splice site probably benign
IGL02852:Dgkd APN 1 87,863,135 (GRCm39) missense probably damaging 1.00
IGL02893:Dgkd APN 1 87,842,930 (GRCm39) splice site probably benign
IGL03367:Dgkd APN 1 87,868,030 (GRCm39) critical splice donor site probably null
R0014:Dgkd UTSW 1 87,809,603 (GRCm39) missense probably damaging 1.00
R0016:Dgkd UTSW 1 87,845,674 (GRCm39) missense probably benign 0.02
R0219:Dgkd UTSW 1 87,865,996 (GRCm39) splice site probably benign
R0496:Dgkd UTSW 1 87,864,622 (GRCm39) missense probably null 0.83
R0559:Dgkd UTSW 1 87,842,826 (GRCm39) missense probably damaging 1.00
R0591:Dgkd UTSW 1 87,842,826 (GRCm39) missense probably damaging 1.00
R1270:Dgkd UTSW 1 87,861,847 (GRCm39) missense probably damaging 0.96
R1599:Dgkd UTSW 1 87,809,608 (GRCm39) missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87,853,990 (GRCm39) missense probably damaging 1.00
R1745:Dgkd UTSW 1 87,859,766 (GRCm39) critical splice donor site probably null
R1959:Dgkd UTSW 1 87,857,549 (GRCm39) missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87,857,549 (GRCm39) missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87,855,413 (GRCm39) missense probably benign
R2148:Dgkd UTSW 1 87,809,643 (GRCm39) missense probably damaging 1.00
R2232:Dgkd UTSW 1 87,857,464 (GRCm39) missense probably benign 0.05
R2266:Dgkd UTSW 1 87,855,540 (GRCm39) unclassified probably benign
R4004:Dgkd UTSW 1 87,863,145 (GRCm39) missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87,863,145 (GRCm39) missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87,869,223 (GRCm39) critical splice donor site probably null
R4235:Dgkd UTSW 1 87,859,704 (GRCm39) nonsense probably null
R4644:Dgkd UTSW 1 87,864,016 (GRCm39) missense probably damaging 1.00
R4747:Dgkd UTSW 1 87,861,889 (GRCm39) missense probably damaging 1.00
R4864:Dgkd UTSW 1 87,844,560 (GRCm39) missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87,865,989 (GRCm39) critical splice donor site probably null
R5365:Dgkd UTSW 1 87,863,138 (GRCm39) missense probably damaging 1.00
R5495:Dgkd UTSW 1 87,854,594 (GRCm39) missense probably damaging 1.00
R5514:Dgkd UTSW 1 87,861,832 (GRCm39) missense probably damaging 1.00
R5729:Dgkd UTSW 1 87,864,054 (GRCm39) nonsense probably null
R5766:Dgkd UTSW 1 87,808,171 (GRCm39) nonsense probably null
R6133:Dgkd UTSW 1 87,865,962 (GRCm39) missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87,864,103 (GRCm39) missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87,851,930 (GRCm39) missense probably damaging 1.00
R6297:Dgkd UTSW 1 87,853,866 (GRCm39) missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87,867,962 (GRCm39) missense probably damaging 1.00
R6846:Dgkd UTSW 1 87,853,413 (GRCm39) splice site probably null
R6905:Dgkd UTSW 1 87,863,097 (GRCm39) missense probably damaging 1.00
R7369:Dgkd UTSW 1 87,849,344 (GRCm39) missense probably damaging 1.00
R7763:Dgkd UTSW 1 87,854,671 (GRCm39) missense probably benign
R7921:Dgkd UTSW 1 87,851,806 (GRCm39) missense probably damaging 0.98
R8087:Dgkd UTSW 1 87,844,569 (GRCm39) missense probably damaging 1.00
R8119:Dgkd UTSW 1 87,845,689 (GRCm39) missense possibly damaging 0.78
R8731:Dgkd UTSW 1 87,844,535 (GRCm39) missense possibly damaging 0.81
R8813:Dgkd UTSW 1 87,843,266 (GRCm39) missense probably damaging 0.99
R8849:Dgkd UTSW 1 87,846,365 (GRCm39) missense probably damaging 0.99
R8906:Dgkd UTSW 1 87,869,157 (GRCm39) missense probably damaging 0.97
R9496:Dgkd UTSW 1 87,857,464 (GRCm39) missense probably benign 0.05
R9743:Dgkd UTSW 1 87,861,850 (GRCm39) missense
Z1176:Dgkd UTSW 1 87,855,532 (GRCm39) missense probably benign 0.05
Z1177:Dgkd UTSW 1 87,844,608 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTATCTGTACCCAAGATCTTCTGG -3'
(R):5'- TGAGCCCATGAGTAAGCCAC -3'

Sequencing Primer
(F):5'- CTGGTTATACCTATCCCAGATGTGTG -3'
(R):5'- TGAGTAAGCCACTGGTAACCC -3'
Posted On 2015-03-25