Incidental Mutation 'R2243:Slc43a3'
ID240714
Institutional Source Beutler Lab
Gene Symbol Slc43a3
Ensembl Gene ENSMUSG00000027074
Gene Namesolute carrier family 43, member 3
SynonymsEeg1, SEEEG-1
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2243 (G1)
Quality Score154
Status Validated
Chromosome2
Chromosomal Location84936579-84958509 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 84948438 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090726] [ENSMUST00000141650]
Predicted Effect probably benign
Transcript: ENSMUST00000090726
SMART Domains Protein: ENSMUSP00000088227
Gene: ENSMUSG00000027074

DomainStartEndE-ValueType
Pfam:MFS_1 12 457 1.2e-20 PFAM
transmembrane domain 470 487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141650
SMART Domains Protein: ENSMUSP00000116513
Gene: ENSMUSG00000027074

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 99 118 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155537
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Slc43a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Slc43a3 APN 2 84938241 missense probably damaging 1.00
IGL02405:Slc43a3 APN 2 84938241 missense probably damaging 1.00
IGL02756:Slc43a3 APN 2 84944268 missense probably benign 0.06
R0276:Slc43a3 UTSW 2 84937663 start gained probably benign
R1158:Slc43a3 UTSW 2 84937796 missense probably benign 0.27
R1865:Slc43a3 UTSW 2 84946901 missense possibly damaging 0.90
R1992:Slc43a3 UTSW 2 84957740 missense probably damaging 0.99
R2073:Slc43a3 UTSW 2 84944612 critical splice donor site probably null
R3819:Slc43a3 UTSW 2 84944552 missense probably damaging 1.00
R4758:Slc43a3 UTSW 2 84944525 missense probably damaging 1.00
R5294:Slc43a3 UTSW 2 84956310 missense probably benign 0.13
R5369:Slc43a3 UTSW 2 84957723 missense probably damaging 0.98
R6516:Slc43a3 UTSW 2 84957761 missense probably benign 0.00
R6729:Slc43a3 UTSW 2 84938285 missense probably damaging 1.00
R7012:Slc43a3 UTSW 2 84946969 missense probably damaging 0.99
R8358:Slc43a3 UTSW 2 84950516 missense probably benign 0.38
R8391:Slc43a3 UTSW 2 84937807 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGAGAAGTGATTCCGTGTGAAG -3'
(R):5'- AAAGACCCTGCCCTTTCTGG -3'

Sequencing Primer
(F):5'- AAGATGAGGATCCTCTCTCTGTGC -3'
(R):5'- CTGGGTCCTCTCTAAAAGTGAG -3'
Posted On2014-10-15