Incidental Mutation 'R2243:Dnaaf2'
ID240739
Institutional Source Beutler Lab
Gene Symbol Dnaaf2
Ensembl Gene ENSMUSG00000020973
Gene Namedynein, axonemal assembly factor 2
Synonyms2810020C19Rik, kintoun, Ktu, 1110034A24Rik
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69189087-69198429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 69196644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 548 (T548P)
Ref Sequence ENSEMBL: ENSMUSP00000021356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000222699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021356
AA Change: T548P

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973
AA Change: T548P

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181850
SMART Domains Protein: ENSMUSP00000137753
Gene: ENSMUSG00000097061

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Predicted Effect unknown
Transcript: ENSMUST00000223192
AA Change: T154P
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a highly conserved protein involved in the preassembly of dynein arm complexes which power cilia. These complexes are found in some cilia and are assembled in the cytoplasm prior to transport for cilia formation. Mutations in the human gene have been associated with primary ciliary dyskinesia. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, reduced body size, situs inversus totalis, hydroencephaly and abnormal brain ependymal and tracheal cilia morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Dnaaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Dnaaf2 APN 12 69196766 missense probably benign 0.23
IGL01321:Dnaaf2 APN 12 69196602 missense probably damaging 1.00
IGL01880:Dnaaf2 APN 12 69190037 missense probably benign 0.17
R0329:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R0330:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R1051:Dnaaf2 UTSW 12 69197795 missense probably damaging 1.00
R1668:Dnaaf2 UTSW 12 69196691 missense probably benign 0.04
R2011:Dnaaf2 UTSW 12 69196785 missense probably damaging 1.00
R2179:Dnaaf2 UTSW 12 69198297 unclassified probably benign
R2356:Dnaaf2 UTSW 12 69198218 missense probably benign 0.01
R4120:Dnaaf2 UTSW 12 69198038 missense possibly damaging 0.85
R5086:Dnaaf2 UTSW 12 69197286 missense probably damaging 1.00
R5205:Dnaaf2 UTSW 12 69192924 missense probably damaging 1.00
R5300:Dnaaf2 UTSW 12 69198228 missense probably damaging 0.99
R5399:Dnaaf2 UTSW 12 69196742 missense probably damaging 0.97
R5739:Dnaaf2 UTSW 12 69196941 missense probably benign
R5765:Dnaaf2 UTSW 12 69192853 missense probably damaging 1.00
R5872:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6043:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6338:Dnaaf2 UTSW 12 69198122 missense probably damaging 1.00
R6503:Dnaaf2 UTSW 12 69197511 missense probably benign 0.42
R6524:Dnaaf2 UTSW 12 69190385 missense probably benign 0.43
R6895:Dnaaf2 UTSW 12 69197663 missense probably benign 0.04
R7490:Dnaaf2 UTSW 12 69197606 missense probably damaging 1.00
R7971:Dnaaf2 UTSW 12 69197345 missense probably damaging 1.00
R8209:Dnaaf2 UTSW 12 69198092 missense probably damaging 1.00
Z1176:Dnaaf2 UTSW 12 69197850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAAATAGTGAGAACGGTTACCTCC -3'
(R):5'- TGTCCAGACGAATGAGGAGC -3'

Sequencing Primer
(F):5'- TAGTGAGAACGGTTACCTCCAAAGAC -3'
(R):5'- GCTCAGCCATGGGTGAC -3'
Posted On2014-10-15