Incidental Mutation 'R2243:Olfr317'
ID240736
Institutional Source Beutler Lab
Gene Symbol Olfr317
Ensembl Gene ENSMUSG00000060030
Gene Nameolfactory receptor 317
SynonymsGA_x6K02T2NKPP-680866-681849, MOR256-47
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58731018-58739212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58732445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 240 (T240M)
Ref Sequence ENSEMBL: ENSMUSP00000150027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075607] [ENSMUST00000215513] [ENSMUST00000216196]
Predicted Effect probably damaging
Transcript: ENSMUST00000075607
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075034
Gene: ENSMUSG00000060030
AA Change: T240M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-50 PFAM
Pfam:7tm_1 41 290 5.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215513
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216196
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Olfr317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Olfr317 APN 11 58732517 missense probably benign 0.07
IGL03330:Olfr317 APN 11 58732919 missense probably damaging 1.00
R0554:Olfr317 UTSW 11 58733039 missense probably damaging 1.00
R1109:Olfr317 UTSW 11 58732916 missense probably benign 0.03
R2012:Olfr317 UTSW 11 58732388 missense possibly damaging 0.60
R2253:Olfr317 UTSW 11 58732995 missense probably benign 0.23
R5400:Olfr317 UTSW 11 58732320 missense possibly damaging 0.74
R6551:Olfr317 UTSW 11 58732757 missense probably damaging 0.99
R6944:Olfr317 UTSW 11 58732242 missense possibly damaging 0.93
R7144:Olfr317 UTSW 11 58732745 missense probably damaging 1.00
R7636:Olfr317 UTSW 11 58732447 missense possibly damaging 0.83
R7985:Olfr317 UTSW 11 58732706 missense possibly damaging 0.49
R8201:Olfr317 UTSW 11 58733114 missense probably damaging 1.00
R8374:Olfr317 UTSW 11 58732898 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTTGTTCCTGAGCGTGTAG -3'
(R):5'- ATGTCTCCAGCAACTCTCAGC -3'

Sequencing Primer
(F):5'- AGCGTGTAGATCAGAGGGTTG -3'
(R):5'- GAGATGCCAGCTCTCATCAGGATG -3'
Posted On2014-10-15