Incidental Mutation 'R2243:Taldo1'
ID240729
Institutional Source Beutler Lab
Gene Symbol Taldo1
Ensembl Gene ENSMUSG00000025503
Gene Nametransaldolase 1
Synonyms
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141392199-141402968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141392304 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 28 (T28K)
Ref Sequence ENSEMBL: ENSMUSP00000026576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026576] [ENSMUST00000211654]
PDB Structure
Crystal structure of mouse transaldolase [X-RAY DIFFRACTION]
Crystal structure of mouse transaldolase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026576
AA Change: T28K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026576
Gene: ENSMUSG00000025503
AA Change: T28K

DomainStartEndE-ValueType
Pfam:Transaldolase 24 326 1.2e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141793
Predicted Effect probably damaging
Transcript: ENSMUST00000211654
AA Change: T28K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.7541 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for maintaining structure and function of mitochondria. Studies in knockout mice identify that deficiency of this gene product is a cause of sperm dysmotility and male infertility. Deficiency of this protein has also been identified as a cause of hepatocarcinogenesis in mice. Two related pseudogenes have been identified on chromosome 10. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene results in male infertility due to defective sperm motility because of functional and structural defects of mitochondria in the sperm. Heterozygous mice show reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Taldo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Taldo1 APN 7 141402734 splice site probably benign
R1470:Taldo1 UTSW 7 141398587 missense probably damaging 1.00
R1470:Taldo1 UTSW 7 141398587 missense probably damaging 1.00
R2060:Taldo1 UTSW 7 141396154 missense probably damaging 1.00
R5610:Taldo1 UTSW 7 141392292 missense probably damaging 1.00
R6284:Taldo1 UTSW 7 141398583 missense possibly damaging 0.76
R8376:Taldo1 UTSW 7 141401875 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTCAGGCTTCATTTAGCTTTG -3'
(R):5'- CAGGGAGACTTTCTCGGACTAC -3'

Sequencing Primer
(F):5'- GCTTTGATTGGCCAGGACGC -3'
(R):5'- GCTCCCAGGGTCACCAATAG -3'
Posted On2014-10-15