Incidental Mutation 'R2243:Foxb1'
ID240732
Institutional Source Beutler Lab
Gene Symbol Foxb1
Ensembl Gene ENSMUSG00000059246
Gene Nameforkhead box B1
SynonymsTWH, Mf3, C43, Foxb1b, Hfh-e5.1, Foxb1a, Fkh5
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R2243 (G1)
Quality Score215
Status Validated
Chromosome9
Chromosomal Location69757710-69760940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69759864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 128 (Y128C)
Ref Sequence ENSEMBL: ENSMUSP00000096197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071281]
Predicted Effect probably damaging
Transcript: ENSMUST00000071281
AA Change: Y128C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096197
Gene: ENSMUSG00000059246
AA Change: Y128C

DomainStartEndE-ValueType
FH 11 101 6.75e-62 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 265 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180914
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Targeted null mutant mice show variable embryonic lethality with neural tube defects or severe posterior reduction. Survivors have high postnatal mortality, reduced growth, motor weakness, midbrain abnormalities and females have a lactational defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Foxb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Foxb1 APN 9 69760198 missense probably damaging 1.00
IGL01475:Foxb1 APN 9 69759268 utr 3 prime probably benign
IGL02153:Foxb1 APN 9 69759703 missense probably benign 0.00
PIT4514001:Foxb1 UTSW 9 69760221 missense probably damaging 1.00
R0570:Foxb1 UTSW 9 69759562 missense probably benign
R1618:Foxb1 UTSW 9 69760011 missense probably damaging 0.96
R1624:Foxb1 UTSW 9 69759316 missense probably benign 0.04
R1665:Foxb1 UTSW 9 69759822 missense probably damaging 0.97
R1913:Foxb1 UTSW 9 69760101 missense possibly damaging 0.51
R4913:Foxb1 UTSW 9 69759577 missense probably benign
R4925:Foxb1 UTSW 9 69760155 missense probably damaging 1.00
R5630:Foxb1 UTSW 9 69760120 missense probably damaging 1.00
R5668:Foxb1 UTSW 9 69760246 start codon destroyed probably damaging 0.96
R7540:Foxb1 UTSW 9 69759859 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCATGGTAGTTAACTGGTTAG -3'
(R):5'- TTCATCAAGATCCCGAGGCG -3'

Sequencing Primer
(F):5'- ATAGGCAGCCGGAACCG -3'
(R):5'- GATCCCGAGGCGGCCAG -3'
Posted On2014-10-15