Incidental Mutation 'R2243:Tatdn3'
ID240712
Institutional Source Beutler Lab
Gene Symbol Tatdn3
Ensembl Gene ENSMUSG00000026632
Gene NameTatD DNase domain containing 3
Synonyms
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191045826-191062932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191052900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 184 (Y184C)
Ref Sequence ENSEMBL: ENSMUSP00000106518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893]
Predicted Effect probably damaging
Transcript: ENSMUST00000027945
AA Change: Y184C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632
AA Change: Y184C

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110891
AA Change: Y184C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632
AA Change: Y184C

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110893
AA Change: Y184C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632
AA Change: Y184C

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156341
Meta Mutation Damage Score 0.6600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Tatdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Tatdn3 APN 1 191055381 splice site probably benign
IGL02819:Tatdn3 APN 1 191055344 missense probably benign 0.04
IGL02898:Tatdn3 APN 1 191046310 makesense probably null
R0718:Tatdn3 UTSW 1 191052849 splice site probably benign
R0892:Tatdn3 UTSW 1 191062805 missense probably benign 0.22
R1635:Tatdn3 UTSW 1 191060176 missense probably benign
R2018:Tatdn3 UTSW 1 191049280 critical splice donor site probably null
R2088:Tatdn3 UTSW 1 191052876 missense possibly damaging 0.59
R3933:Tatdn3 UTSW 1 191046324 splice site probably null
R4676:Tatdn3 UTSW 1 191049334 missense probably damaging 1.00
R5047:Tatdn3 UTSW 1 191046278 missense probably damaging 1.00
R5923:Tatdn3 UTSW 1 191049310 missense probably damaging 1.00
R6044:Tatdn3 UTSW 1 191056361 critical splice donor site probably null
R6066:Tatdn3 UTSW 1 191046268 missense probably benign 0.24
R7770:Tatdn3 UTSW 1 191058856 missense probably benign 0.05
R8331:Tatdn3 UTSW 1 191046211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTACTGTCCACTGTGCCAC -3'
(R):5'- GCAATGGAATATGATCTTGGCATC -3'

Sequencing Primer
(F):5'- TCTCCAGTCTGCCGCAG -3'
(R):5'- GGAAGCTCTTTGTTAGGAGA -3'
Posted On2014-10-15