Mutagenetix > Incidental Mutation

Incidental Mutation 'R2259:Myo7a'

243639

Institutional Source

Beutler Lab

Gene Symbol

Myo7a

Ensembl Gene

ENSMUSG00000030761

Gene Name

myosin VIIA

Synonyms

Myo7, nmf371, polka, Hdb, USH1B

MMRRC Submission

040259-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2259 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98051060-98119524 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 98069499 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1388 (D1388A)

Ref Sequence

ENSEMBL: ENSMUSP00000146165 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000156992] [ENSMUST00000205746]

AlphaFold

P97479

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084979
AA Change: D1388A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: D1388A

Domain	Start	End	E-Value	Type
MYSc	48	731	N/A	SMART
IQ	732	754	2.99e0	SMART
IQ	755	777	8.77e-7	SMART
IQ	801	823	8e0	SMART
IQ	824	846	8.7e0	SMART
low complexity region	854	889	N/A	INTRINSIC
low complexity region	893	916	N/A	INTRINSIC
low complexity region	972	985	N/A	INTRINSIC
MyTH4	1006	1242	1.4e-71	SMART
B41	1243	1458	8.82e-42	SMART
SH3	1557	1622	4.93e-7	SMART
MyTH4	1698	1847	3.95e-57	SMART
B41	1849	2066	8.27e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107122
AA Change: D1394A

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: D1394A

Domain	Start	End	E-Value	Type
MYSc	48	737	N/A	SMART
IQ	738	760	2.99e0	SMART
IQ	761	783	8.77e-7	SMART
IQ	807	829	8e0	SMART
IQ	830	852	8.7e0	SMART
low complexity region	860	895	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	978	991	N/A	INTRINSIC
MyTH4	1012	1248	1.4e-71	SMART
B41	1249	1464	8.82e-42	SMART
SH3	1563	1628	4.93e-7	SMART
MyTH4	1704	1853	3.95e-57	SMART
B41	1855	2072	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107127
AA Change: D1399A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: D1399A

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1568	1633	4.93e-7	SMART
MyTH4	1709	1858	3.95e-57	SMART
B41	1860	2077	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107128
AA Change: D1399A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: D1399A

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1606	1671	4.93e-7	SMART
MyTH4	1747	1896	3.95e-57	SMART
B41	1898	2115	8.27e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124787

Predicted Effect

probably benign
Transcript: ENSMUST00000156992

Predicted Effect

probably damaging
Transcript: ENSMUST00000205746
AA Change: D1388A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,112,311	S91A	possibly damaging	Het
Ankrd13b	T	G	11: 77,476,342	N247T	probably damaging	Het
Atp10b	A	G	11: 43,172,745	D169G	probably damaging	Het
Atp10b	G	A	11: 43,189,613	V239M	probably damaging	Het
Cflar	C	T	1: 58,729,121	T121I	probably benign	Het
Clca3b	T	C	3: 144,846,381	N180D	possibly damaging	Het
Cnbd2	T	A	2: 156,335,272	I62N	probably damaging	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Cyp2a4	C	T	7: 26,309,035	L201F	probably damaging	Het
D630003M21Rik	A	T	2: 158,204,711	L782Q	probably damaging	Het
Dctn1	C	A	6: 83,197,586	H1065N	possibly damaging	Het
Dgcr2	A	T	16: 17,844,977		probably null	Het
Dlg4	T	C	11: 70,031,370	I143T	probably damaging	Het
E2f7	T	G	10: 110,746,343	N4K	probably damaging	Het
Eef2kmt	C	T	16: 5,245,308	V323I	probably benign	Het
Eif2ak4	A	C	2: 118,455,783	I1017L	probably damaging	Het
Eln	C	A	5: 134,729,654	A126S	unknown	Het
Exoc7	T	C	11: 116,306,411	S35G	probably damaging	Het
Fam187a	A	G	11: 102,885,298		probably benign	Het
Fam196a	T	A	7: 134,917,667	E378V	probably damaging	Het
Fkbp6	C	T	5: 135,337,614		probably null	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fmn2	T	A	1: 174,502,932	L296H	unknown	Het
Galnt14	C	A	17: 73,494,266	M520I	probably benign	Het
Gba2	A	G	4: 43,570,107	C396R	probably benign	Het
Gigyf1	C	A	5: 137,520,332	A215E	possibly damaging	Het
Glb1	C	T	9: 114,443,032	Q246*	probably null	Het
Gm11565	T	G	11: 99,915,018	C79G	possibly damaging	Het
Gpr160	A	G	3: 30,896,295	Y172C	probably damaging	Het
Ift52	A	G	2: 163,028,093	N159S	probably benign	Het
Insrr	A	G	3: 87,800,452	D67G	probably damaging	Het
Irf2	A	G	8: 46,837,833	Y230C	probably benign	Het
Jmjd6	T	C	11: 116,841,314	H187R	probably damaging	Het
Kdm2b	C	T	5: 122,882,416	G90S	probably damaging	Het
Kif7	C	T	7: 79,711,589	G118D	probably damaging	Het
Klhl38	G	C	15: 58,314,978	T532S	possibly damaging	Het
Kmt2a	G	T	9: 44,881,142		probably benign	Het
Lama2	A	G	10: 27,031,127	L2346S	probably benign	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mettl7a1	A	T	15: 100,313,168	I174F	probably benign	Het
Mllt6	T	C	11: 97,664,976	V44A	probably damaging	Het
Muc5ac	A	G	7: 141,791,008	N72S	probably benign	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Ncoa1	A	C	12: 4,315,819	H82Q	probably damaging	Het
Npbwr1	C	A	1: 5,916,658	L212F	probably damaging	Het
Nptx1	T	G	11: 119,543,316	I315L	probably benign	Het
Npy2r	G	T	3: 82,541,354	P38Q	possibly damaging	Het
Ocln	A	T	13: 100,535,029	D24E	probably damaging	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr295	T	A	7: 86,585,884	V203D	possibly damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Phf3	A	G	1: 30,804,343	V1845A	probably benign	Het
Plch1	T	A	3: 63,697,977	Q1493L	possibly damaging	Het
Pold1	T	C	7: 44,541,484		probably benign	Het
Polq	T	C	16: 37,062,097	V1541A	probably benign	Het
Psmd3	T	A	11: 98,690,964	M305K	probably benign	Het
Pura	T	C	18: 36,287,750	F197L	possibly damaging	Het
Rab3gap2	T	A	1: 185,221,859	W43R	probably damaging	Het
Repin1	A	G	6: 48,596,530	Q128R	probably benign	Het
Rnf208	G	A	2: 25,243,644	V117I	probably damaging	Het
Rpe65	A	G	3: 159,615,571	Y340C	probably damaging	Het
Ryr1	C	A	7: 29,019,741	V4414L	unknown	Het
Sephs2	T	C	7: 127,273,477	E148G	possibly damaging	Het
Spns2	T	A	11: 72,457,268	Q291L	probably benign	Het
Ssc5d	C	T	7: 4,943,916	P1090S	probably benign	Het
Tasp1	A	T	2: 139,951,506	V250D	probably damaging	Het
Tcaf3	A	G	6: 42,591,430	I664T	possibly damaging	Het
Tg	T	C	15: 66,683,898	V813A	probably benign	Het
Tmem132c	T	C	5: 127,504,924	L401P	probably benign	Het
Tmem138	T	C	19: 10,571,603	N101S	probably benign	Het
Tmem242	G	T	17: 5,433,470	A99E	probably damaging	Het
Tmem30a	C	T	9: 79,774,164	R277H	probably benign	Het
Tnni3	T	A	7: 4,519,406	I182F	probably benign	Het
Trim30a	T	A	7: 104,411,504	D355V	probably damaging	Het
Trim35	C	T	14: 66,309,262	R493*	probably null	Het
Trip10	G	C	17: 57,255,135	V254L	probably benign	Het
Tshz2	A	T	2: 169,886,406	Q505L	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Unc13b	A	T	4: 43,182,780	E3163V	possibly damaging	Het
Unc45b	T	A	11: 82,917,799	M237K	probably benign	Het
Usp8	A	G	2: 126,758,568	T1080A	probably benign	Het
Vmn2r65	T	A	7: 84,940,911	H599L	possibly damaging	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het
Zfp407	G	T	18: 84,209,793	T1897K	probably damaging	Het
Zzef1	C	T	11: 72,900,633	R2188*	probably null	Het

Other mutations in Myo7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Myo7a	APN	7	98102626	missense	probably damaging	1.00
IGL00785:Myo7a	APN	7	98054348	missense	probably damaging	0.99
IGL00840:Myo7a	APN	7	98051659	missense	probably benign	0.25
IGL01362:Myo7a	APN	7	98097702	missense	probably damaging	1.00
IGL01484:Myo7a	APN	7	98085422	missense	probably damaging	1.00
IGL01673:Myo7a	APN	7	98054708	missense	probably benign	0.00
IGL01933:Myo7a	APN	7	98083142	missense	probably damaging	1.00
IGL01943:Myo7a	APN	7	98065647	missense	possibly damaging	0.96
IGL02188:Myo7a	APN	7	98091027	missense	probably damaging	0.96
IGL02304:Myo7a	APN	7	98077736	missense	possibly damaging	0.89
IGL02305:Myo7a	APN	7	98051629	makesense	probably null
IGL02331:Myo7a	APN	7	98053182	missense	possibly damaging	0.95
IGL02386:Myo7a	APN	7	98075112	missense	probably damaging	0.99
IGL02389:Myo7a	APN	7	98106991	critical splice donor site	probably null
IGL02832:Myo7a	APN	7	98091020	critical splice donor site	probably null
IGL02839:Myo7a	APN	7	98091122	missense	probably damaging	1.00
IGL03193:Myo7a	APN	7	98091057	missense	probably damaging	1.00
IGL03237:Myo7a	APN	7	98102593	missense	probably damaging	1.00
IGL03384:Myo7a	APN	7	98093593	missense	probably damaging	1.00
coward	UTSW	7	98085466	missense	probably damaging	1.00
H8786:Myo7a	UTSW	7	98095778	missense	possibly damaging	0.61
IGL03046:Myo7a	UTSW	7	98079327	missense	probably damaging	1.00
IGL03134:Myo7a	UTSW	7	98056767	missense	probably damaging	0.96
PIT4696001:Myo7a	UTSW	7	98063599	missense	probably benign	0.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0267:Myo7a	UTSW	7	98054624	missense	probably benign	0.08
R0408:Myo7a	UTSW	7	98056781	missense	probably damaging	1.00
R0411:Myo7a	UTSW	7	98071937	missense	probably benign	0.00
R0540:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0607:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0629:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R0632:Myo7a	UTSW	7	98112150	intron	probably benign
R0659:Myo7a	UTSW	7	98054338	splice site	probably benign
R0735:Myo7a	UTSW	7	98081180	splice site	probably benign
R0924:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R0930:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R1018:Myo7a	UTSW	7	98107005	missense	probably damaging	1.00
R1196:Myo7a	UTSW	7	98097673	missense	possibly damaging	0.87
R1331:Myo7a	UTSW	7	98107008	missense	probably benign	0.00
R1487:Myo7a	UTSW	7	98053810	critical splice donor site	probably null
R1676:Myo7a	UTSW	7	98099472	critical splice donor site	probably null
R1695:Myo7a	UTSW	7	98092496	missense	possibly damaging	0.94
R1770:Myo7a	UTSW	7	98112606	intron	probably benign
R1781:Myo7a	UTSW	7	98073124	missense	probably damaging	1.00
R1789:Myo7a	UTSW	7	98107095	missense	probably damaging	0.99
R1827:Myo7a	UTSW	7	98076731	missense	probably damaging	0.99
R1864:Myo7a	UTSW	7	98052256	missense	probably damaging	1.00
R1955:Myo7a	UTSW	7	98054921	missense	probably damaging	1.00
R2011:Myo7a	UTSW	7	98054708	missense	possibly damaging	0.69
R2229:Myo7a	UTSW	7	98054910	missense	probably benign	0.12
R2443:Myo7a	UTSW	7	98095769	missense	probably benign	0.07
R2898:Myo7a	UTSW	7	98054424	nonsense	probably null
R2898:Myo7a	UTSW	7	98097206	missense	probably damaging	1.00
R3158:Myo7a	UTSW	7	98052292	missense	probably damaging	1.00
R3408:Myo7a	UTSW	7	98081087	missense	probably benign	0.00
R4222:Myo7a	UTSW	7	98073229	missense	possibly damaging	0.93
R4255:Myo7a	UTSW	7	98071964	missense	probably damaging	0.96
R4374:Myo7a	UTSW	7	98102674	missense	probably damaging	1.00
R4429:Myo7a	UTSW	7	98053188	missense	probably damaging	0.99
R4445:Myo7a	UTSW	7	98066404	missense	probably damaging	1.00
R4579:Myo7a	UTSW	7	98073193	missense	probably damaging	1.00
R4659:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R5073:Myo7a	UTSW	7	98073218	nonsense	probably null
R5138:Myo7a	UTSW	7	98083599	missense	probably damaging	1.00
R5566:Myo7a	UTSW	7	98064816	missense	possibly damaging	0.93
R5580:Myo7a	UTSW	7	98073160	missense	probably damaging	1.00
R6079:Myo7a	UTSW	7	98065790	nonsense	probably null
R6138:Myo7a	UTSW	7	98065790	nonsense	probably null
R6451:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6452:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6453:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6454:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6455:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6465:Myo7a	UTSW	7	98062680	missense	possibly damaging	0.95
R6653:Myo7a	UTSW	7	98054503	missense	probably damaging	0.96
R6709:Myo7a	UTSW	7	98054699	missense	probably damaging	1.00
R6917:Myo7a	UTSW	7	98095763	missense	possibly damaging	0.58
R7313:Myo7a	UTSW	7	98064195	missense	probably damaging	0.99
R7334:Myo7a	UTSW	7	98079366	missense	probably benign
R7356:Myo7a	UTSW	7	98102683	missense	probably benign	0.01
R7393:Myo7a	UTSW	7	98063699	missense	possibly damaging	0.91
R7422:Myo7a	UTSW	7	98051626	splice site	probably null
R7472:Myo7a	UTSW	7	98064793	missense	probably damaging	1.00
R7483:Myo7a	UTSW	7	98063674	missense	probably benign	0.07
R7526:Myo7a	UTSW	7	98085448	missense	possibly damaging	0.49
R7948:Myo7a	UTSW	7	98075029	missense	probably damaging	1.00
R8069:Myo7a	UTSW	7	98083626	nonsense	probably null
R8115:Myo7a	UTSW	7	98066446	missense	probably damaging	0.98
R8150:Myo7a	UTSW	7	98063639	missense	probably benign	0.19
R8265:Myo7a	UTSW	7	98085397	missense	probably benign	0.00
R8289:Myo7a	UTSW	7	98077169	missense	probably benign
R8298:Myo7a	UTSW	7	98098334	missense	probably damaging	1.00
R8518:Myo7a	UTSW	7	98091063	missense	possibly damaging	0.58
R8539:Myo7a	UTSW	7	98072461	missense	probably damaging	0.99
R8557:Myo7a	UTSW	7	98053874	missense	probably benign	0.08
R8685:Myo7a	UTSW	7	98097127	missense	probably benign	0.03
R8902:Myo7a	UTSW	7	98092613	missense	probably damaging	1.00
R9034:Myo7a	UTSW	7	98079258	missense	probably benign	0.40
R9090:Myo7a	UTSW	7	98091074	missense	probably benign	0.04
R9172:Myo7a	UTSW	7	98083162	missense	probably benign
R9271:Myo7a	UTSW	7	98091074	missense	probably benign	0.04
R9334:Myo7a	UTSW	7	98067162	missense	probably damaging	1.00
R9356:Myo7a	UTSW	7	98076666	missense	probably benign	0.11
R9444:Myo7a	UTSW	7	98093491	missense	possibly damaging	0.84
R9459:Myo7a	UTSW	7	98073173	missense	possibly damaging	0.65
R9513:Myo7a	UTSW	7	98097611	critical splice donor site	probably null
R9517:Myo7a	UTSW	7	98071959	missense	probably damaging	1.00
R9629:Myo7a	UTSW	7	98063730	missense	probably benign	0.03
R9662:Myo7a	UTSW	7	98098292	missense	possibly damaging	0.55
R9709:Myo7a	UTSW	7	98094329	missense	possibly damaging	0.79
RF005:Myo7a	UTSW	7	98093617	missense	probably benign	0.42
U15987:Myo7a	UTSW	7	98065790	nonsense	probably null
X0028:Myo7a	UTSW	7	98065725	missense	probably damaging	1.00
X0058:Myo7a	UTSW	7	98062648	missense	probably benign	0.02
Z1176:Myo7a	UTSW	7	98095727	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98052226	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98085523	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCAGGTGCCAGCCATGATG -3'
(R):5'- AAGAGTATGGCTATGGGCTTAG -3'

Sequencing Primer
(F):5'- AGCCATGATGCTCCATGC -3'
(R):5'- CCCCATGATTGCCTTGTGAAGAG -3'

Posted On

2014-10-16