Incidental Mutation 'R2259:Tg'
ID 243678
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 040259-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R2259 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 66670753-66850721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66683898 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 813 (V813A)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065916
AA Change: V813A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: V813A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,112,311 S91A possibly damaging Het
Ankrd13b T G 11: 77,476,342 N247T probably damaging Het
Atp10b A G 11: 43,172,745 D169G probably damaging Het
Atp10b G A 11: 43,189,613 V239M probably damaging Het
Cflar C T 1: 58,729,121 T121I probably benign Het
Clca3b T C 3: 144,846,381 N180D possibly damaging Het
Cnbd2 T A 2: 156,335,272 I62N probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Cyp2a4 C T 7: 26,309,035 L201F probably damaging Het
D630003M21Rik A T 2: 158,204,711 L782Q probably damaging Het
Dctn1 C A 6: 83,197,586 H1065N possibly damaging Het
Dgcr2 A T 16: 17,844,977 probably null Het
Dlg4 T C 11: 70,031,370 I143T probably damaging Het
E2f7 T G 10: 110,746,343 N4K probably damaging Het
Eef2kmt C T 16: 5,245,308 V323I probably benign Het
Eif2ak4 A C 2: 118,455,783 I1017L probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Exoc7 T C 11: 116,306,411 S35G probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam196a T A 7: 134,917,667 E378V probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fmn2 T A 1: 174,502,932 L296H unknown Het
Galnt14 C A 17: 73,494,266 M520I probably benign Het
Gba2 A G 4: 43,570,107 C396R probably benign Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Glb1 C T 9: 114,443,032 Q246* probably null Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gpr160 A G 3: 30,896,295 Y172C probably damaging Het
Ift52 A G 2: 163,028,093 N159S probably benign Het
Insrr A G 3: 87,800,452 D67G probably damaging Het
Irf2 A G 8: 46,837,833 Y230C probably benign Het
Jmjd6 T C 11: 116,841,314 H187R probably damaging Het
Kdm2b C T 5: 122,882,416 G90S probably damaging Het
Kif7 C T 7: 79,711,589 G118D probably damaging Het
Klhl38 G C 15: 58,314,978 T532S possibly damaging Het
Kmt2a G T 9: 44,881,142 probably benign Het
Lama2 A G 10: 27,031,127 L2346S probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo7a T G 7: 98,069,499 D1388A probably damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Ncoa1 A C 12: 4,315,819 H82Q probably damaging Het
Npbwr1 C A 1: 5,916,658 L212F probably damaging Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Npy2r G T 3: 82,541,354 P38Q possibly damaging Het
Ocln A T 13: 100,535,029 D24E probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr295 T A 7: 86,585,884 V203D possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Phf3 A G 1: 30,804,343 V1845A probably benign Het
Plch1 T A 3: 63,697,977 Q1493L possibly damaging Het
Pold1 T C 7: 44,541,484 probably benign Het
Polq T C 16: 37,062,097 V1541A probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Pura T C 18: 36,287,750 F197L possibly damaging Het
Rab3gap2 T A 1: 185,221,859 W43R probably damaging Het
Repin1 A G 6: 48,596,530 Q128R probably benign Het
Rnf208 G A 2: 25,243,644 V117I probably damaging Het
Rpe65 A G 3: 159,615,571 Y340C probably damaging Het
Ryr1 C A 7: 29,019,741 V4414L unknown Het
Sephs2 T C 7: 127,273,477 E148G possibly damaging Het
Spns2 T A 11: 72,457,268 Q291L probably benign Het
Ssc5d C T 7: 4,943,916 P1090S probably benign Het
Tasp1 A T 2: 139,951,506 V250D probably damaging Het
Tcaf3 A G 6: 42,591,430 I664T possibly damaging Het
Tmem132c T C 5: 127,504,924 L401P probably benign Het
Tmem138 T C 19: 10,571,603 N101S probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tnni3 T A 7: 4,519,406 I182F probably benign Het
Trim30a T A 7: 104,411,504 D355V probably damaging Het
Trim35 C T 14: 66,309,262 R493* probably null Het
Trip10 G C 17: 57,255,135 V254L probably benign Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Unc13b A T 4: 43,182,780 E3163V possibly damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Usp8 A G 2: 126,758,568 T1080A probably benign Het
Vmn2r65 T A 7: 84,940,911 H599L possibly damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zfp407 G T 18: 84,209,793 T1897K probably damaging Het
Zzef1 C T 11: 72,900,633 R2188* probably null Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
foster UTSW 15 66693260 nonsense probably null
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
Pipistrella UTSW 15 66696135 missense probably damaging 1.00
pluribus UTSW 15 66715163 missense probably damaging 0.98
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
Vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7790:Tg UTSW 15 66849604 missense probably damaging 0.99
R7838:Tg UTSW 15 66693263 missense probably benign 0.00
R7890:Tg UTSW 15 66683814 missense probably damaging 1.00
R7904:Tg UTSW 15 66705279 missense probably benign 0.08
R7919:Tg UTSW 15 66684074 missense possibly damaging 0.73
R7921:Tg UTSW 15 66683793 missense probably benign 0.08
R8037:Tg UTSW 15 66688875 missense probably benign 0.00
R8038:Tg UTSW 15 66688875 missense probably benign 0.00
R8214:Tg UTSW 15 66773398 missense probably damaging 1.00
R8304:Tg UTSW 15 66693260 nonsense probably null
R8688:Tg UTSW 15 66694953 critical splice donor site probably benign
R8709:Tg UTSW 15 66681937 missense probably benign 0.08
R8714:Tg UTSW 15 66684042 missense probably damaging 0.97
R8901:Tg UTSW 15 66685335 missense probably damaging 1.00
R8917:Tg UTSW 15 66773483 critical splice donor site probably null
R9023:Tg UTSW 15 66683673 missense probably damaging 1.00
R9232:Tg UTSW 15 66698461 missense probably benign 0.01
R9310:Tg UTSW 15 66827269 missense possibly damaging 0.69
R9361:Tg UTSW 15 66685397 missense possibly damaging 0.50
R9389:Tg UTSW 15 66689324 missense probably benign 0.04
R9501:Tg UTSW 15 66847074 missense possibly damaging 0.52
R9510:Tg UTSW 15 66674064 missense probably damaging 1.00
R9594:Tg UTSW 15 66735260 nonsense probably null
R9629:Tg UTSW 15 66683738 missense possibly damaging 0.95
R9701:Tg UTSW 15 66766142 missense probably benign 0.03
R9743:Tg UTSW 15 66689990 missense probably benign 0.18
R9748:Tg UTSW 15 66847159 missense possibly damaging 0.91
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Z1177:Tg UTSW 15 66685310 missense possibly damaging 0.49
Z1177:Tg UTSW 15 66849547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTCTCGAACTCCAGCATG -3'
(R):5'- GGCTGAGCTGACCATTTAGG -3'

Sequencing Primer
(F):5'- AACTCCAGCATGGTGCC -3'
(R):5'- GAGCTGACCATTTAGGATCTGCC -3'
Posted On 2014-10-16