Mutagenetix > Incidental Mutations

Incidental Mutation 'R0632:Myo7a'

59709

Institutional Source

Beutler Lab

Gene Symbol

Myo7a

Ensembl Gene

ENSMUSG00000030761

Gene Name

myosin VIIA

Synonyms

Myo7, nmf371, polka, Hdb, USH1B

MMRRC Submission

038821-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0632 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98051060-98119524 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 98112150 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114944 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]

Predicted Effect

probably benign
Transcript: ENSMUST00000084979

SMART Domains

Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
MYSc	48	731	N/A	SMART
IQ	732	754	2.99e0	SMART
IQ	755	777	8.77e-7	SMART
IQ	801	823	8e0	SMART
IQ	824	846	8.7e0	SMART
low complexity region	854	889	N/A	INTRINSIC
low complexity region	893	916	N/A	INTRINSIC
low complexity region	972	985	N/A	INTRINSIC
MyTH4	1006	1242	1.4e-71	SMART
B41	1243	1458	8.82e-42	SMART
SH3	1557	1622	4.93e-7	SMART
MyTH4	1698	1847	3.95e-57	SMART
B41	1849	2066	8.27e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107122

SMART Domains

Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
MYSc	48	737	N/A	SMART
IQ	738	760	2.99e0	SMART
IQ	761	783	8.77e-7	SMART
IQ	807	829	8e0	SMART
IQ	830	852	8.7e0	SMART
low complexity region	860	895	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	978	991	N/A	INTRINSIC
MyTH4	1012	1248	1.4e-71	SMART
B41	1249	1464	8.82e-42	SMART
SH3	1563	1628	4.93e-7	SMART
MyTH4	1704	1853	3.95e-57	SMART
B41	1855	2072	8.27e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107127

SMART Domains

Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1568	1633	4.93e-7	SMART
MyTH4	1709	1858	3.95e-57	SMART
B41	1860	2077	8.27e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107128

SMART Domains

Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1606	1671	4.93e-7	SMART
MyTH4	1747	1896	3.95e-57	SMART
B41	1898	2115	8.27e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131632

Predicted Effect

probably benign
Transcript: ENSMUST00000138627

SMART Domains

Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	67	139	7.1e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153657

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,227,618	D83G	probably benign	Het
Acaa1a	T	A	9: 119,347,818		probably benign	Het
Adgrg7	T	A	16: 56,742,589	T462S	possibly damaging	Het
Akap6	A	T	12: 52,937,148	N825I	probably damaging	Het
Ankib1	T	A	5: 3,772,529	N59I	probably benign	Het
Anks6	T	C	4: 47,033,167	S633G	possibly damaging	Het
Ap4e1	C	A	2: 127,049,280	Y522*	probably null	Het
Art5	G	A	7: 102,097,957	T205I	probably damaging	Het
Ascc2	T	A	11: 4,649,855	L176H	probably damaging	Het
Atp13a5	T	C	16: 29,298,208	D529G	probably benign	Het
C2cd4a	T	C	9: 67,831,563	E66G	probably benign	Het
C8a	T	C	4: 104,856,492	D147G	probably damaging	Het
Ccdc109b	T	C	3: 129,918,726	M167V	probably benign	Het
Ccdc14	T	C	16: 34,721,649	V532A	possibly damaging	Het
Ccdc88a	T	A	11: 29,482,749		probably benign	Het
Cfap54	C	T	10: 92,885,096	E2543K	unknown	Het
Cldn13	C	T	5: 134,914,747	E195K	probably benign	Het
Cp	A	G	3: 19,971,082	S402G	probably null	Het
Cpa3	T	C	3: 20,225,194	T194A	probably benign	Het
Crygf	C	A	1: 65,927,997	Y93*	probably null	Het
Ctsh	A	G	9: 90,061,582	R87G	possibly damaging	Het
Cyp2t4	A	G	7: 27,158,246	D428G	possibly damaging	Het
Dnah17	C	G	11: 118,067,682		probably benign	Het
Dnah3	A	G	7: 119,967,905	V2366A	probably benign	Het
Dscaml1	A	T	9: 45,732,134	I1284F	probably benign	Het
Dsg1c	T	C	18: 20,272,346		probably benign	Het
Dst	G	T	1: 34,271,413	R4098L	probably damaging	Het
Efhb	A	G	17: 53,413,459		probably benign	Het
Epha7	A	T	4: 28,821,104	I90F	probably damaging	Het
Fam171a2	T	A	11: 102,437,881	D684V	probably damaging	Het
Fan1	A	G	7: 64,363,199	V665A	possibly damaging	Het
Fbn2	A	G	18: 58,037,747	C2191R	probably damaging	Het
Fkbp3	G	A	12: 65,073,918	A2V	probably benign	Het
G6pd2	A	G	5: 61,810,171	N430D	probably benign	Het
Gm13119	G	A	4: 144,363,782	C464Y	probably damaging	Het
Gm13547	T	A	2: 29,761,584	D7E	possibly damaging	Het
Hdac5	A	T	11: 102,205,812	D260E	probably damaging	Het
Hist1h4i	G	T	13: 22,041,027	Y99*	probably null	Het
Hsf2bp	T	C	17: 32,013,346	E142G	probably damaging	Het
Igf1r	C	T	7: 68,165,155	T268I	probably damaging	Het
Kcne3	C	T	7: 100,184,439	R88C	probably damaging	Het
Klk1b9	G	T	7: 43,979,372	G100V	possibly damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lama1	C	T	17: 67,752,368		probably benign	Het
Lcp2	C	T	11: 34,082,426	P335S	possibly damaging	Het
Lrrk2	T	A	15: 91,796,028	N2047K	probably damaging	Het
Mia2	T	C	12: 59,136,143	L36P	probably damaging	Het
Mmp13	G	A	9: 7,274,032	G169R	probably damaging	Het
Mmp13	A	T	9: 7,282,077	I460F	possibly damaging	Het
Msh4	A	G	3: 153,896,895	I232T	probably damaging	Het
Msra	T	A	14: 64,210,532	M145L	probably benign	Het
Nme8	A	T	13: 19,658,036	N422K	probably damaging	Het
Nol6	A	T	4: 41,121,115	F353I	probably damaging	Het
Nphp3	A	G	9: 104,018,274	K384E	probably damaging	Het
Olfr572	C	T	7: 102,928,604		probably null	Het
Olfr652	A	G	7: 104,564,337	I39V	probably benign	Het
Olfr672	A	G	7: 104,996,703	I67T	probably benign	Het
Phox2b	T	G	5: 67,096,214		probably benign	Het
Plec	A	T	15: 76,173,411	S4131T	probably damaging	Het
Pptc7	G	A	5: 122,313,591		probably benign	Het
Prpf40b	A	G	15: 99,316,289	E810G	probably benign	Het
Ptprc	C	T	1: 138,073,610	V965I	probably benign	Het
Pum1	T	A	4: 130,728,104	M180K	probably benign	Het
Ranbp3	T	C	17: 56,702,896		probably benign	Het
Rasgrf2	A	G	13: 91,972,274	S787P	probably benign	Het
Rnf19b	T	A	4: 129,073,551	N294K	probably damaging	Het
Samd3	A	T	10: 26,244,495	H156L	possibly damaging	Het
Serpinb6c	C	T	13: 33,880,031	R347Q	possibly damaging	Het
Slc36a3	A	G	11: 55,125,080	I416T	probably damaging	Het
Slc4a4	T	A	5: 89,129,641	F279Y	probably damaging	Het
Slc6a2	T	A	8: 92,992,801		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tab2	A	G	10: 7,919,801	S232P	probably benign	Het
Tacc2	A	T	7: 130,625,595	K1356*	probably null	Het
Tmem87a	A	G	2: 120,359,542	S544P	probably damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Usp38	A	T	8: 81,014,150	V96E	probably benign	Het
Vmn2r59	T	C	7: 42,058,884	Y33C	probably damaging	Het
Vsig10l	T	G	7: 43,464,137	V171G	probably damaging	Het
Zfp957	T	A	14: 79,212,920	I480F	probably damaging	Het

Other mutations in Myo7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Myo7a	APN	7	98102626	missense	probably damaging	1.00
IGL00785:Myo7a	APN	7	98054348	missense	probably damaging	0.99
IGL00840:Myo7a	APN	7	98051659	missense	probably benign	0.25
IGL01362:Myo7a	APN	7	98097702	missense	probably damaging	1.00
IGL01484:Myo7a	APN	7	98085422	missense	probably damaging	1.00
IGL01673:Myo7a	APN	7	98054708	missense	probably benign	0.00
IGL01933:Myo7a	APN	7	98083142	missense	probably damaging	1.00
IGL01943:Myo7a	APN	7	98065647	missense	possibly damaging	0.96
IGL02188:Myo7a	APN	7	98091027	missense	probably damaging	0.96
IGL02304:Myo7a	APN	7	98077736	missense	possibly damaging	0.89
IGL02305:Myo7a	APN	7	98051629	makesense	probably null
IGL02331:Myo7a	APN	7	98053182	missense	possibly damaging	0.95
IGL02386:Myo7a	APN	7	98075112	missense	probably damaging	0.99
IGL02389:Myo7a	APN	7	98106991	critical splice donor site	probably null
IGL02832:Myo7a	APN	7	98091020	critical splice donor site	probably null
IGL02839:Myo7a	APN	7	98091122	missense	probably damaging	1.00
IGL03193:Myo7a	APN	7	98091057	missense	probably damaging	1.00
IGL03237:Myo7a	APN	7	98102593	missense	probably damaging	1.00
IGL03384:Myo7a	APN	7	98093593	missense	probably damaging	1.00
coward	UTSW	7	98085466	missense	probably damaging	1.00
H8786:Myo7a	UTSW	7	98095778	missense	possibly damaging	0.61
IGL03046:Myo7a	UTSW	7	98079327	missense	probably damaging	1.00
IGL03134:Myo7a	UTSW	7	98056767	missense	probably damaging	0.96
PIT4696001:Myo7a	UTSW	7	98063599	missense	probably benign	0.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0267:Myo7a	UTSW	7	98054624	missense	probably benign	0.08
R0408:Myo7a	UTSW	7	98056781	missense	probably damaging	1.00
R0411:Myo7a	UTSW	7	98071937	missense	probably benign	0.00
R0540:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0607:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0629:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R0659:Myo7a	UTSW	7	98054338	splice site	probably benign
R0735:Myo7a	UTSW	7	98081180	splice site	probably benign
R0924:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R0930:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R1018:Myo7a	UTSW	7	98107005	missense	probably damaging	1.00
R1196:Myo7a	UTSW	7	98097673	missense	possibly damaging	0.87
R1331:Myo7a	UTSW	7	98107008	missense	probably benign	0.00
R1487:Myo7a	UTSW	7	98053810	critical splice donor site	probably null
R1676:Myo7a	UTSW	7	98099472	critical splice donor site	probably null
R1695:Myo7a	UTSW	7	98092496	missense	possibly damaging	0.94
R1770:Myo7a	UTSW	7	98112606	intron	probably benign
R1781:Myo7a	UTSW	7	98073124	missense	probably damaging	1.00
R1789:Myo7a	UTSW	7	98107095	missense	probably damaging	0.99
R1827:Myo7a	UTSW	7	98076731	missense	probably damaging	0.99
R1864:Myo7a	UTSW	7	98052256	missense	probably damaging	1.00
R1955:Myo7a	UTSW	7	98054921	missense	probably damaging	1.00
R2011:Myo7a	UTSW	7	98054708	missense	possibly damaging	0.69
R2229:Myo7a	UTSW	7	98054910	missense	probably benign	0.12
R2259:Myo7a	UTSW	7	98069499	missense	probably damaging	1.00
R2443:Myo7a	UTSW	7	98095769	missense	probably benign	0.07
R2898:Myo7a	UTSW	7	98054424	nonsense	probably null
R2898:Myo7a	UTSW	7	98097206	missense	probably damaging	1.00
R3158:Myo7a	UTSW	7	98052292	missense	probably damaging	1.00
R3408:Myo7a	UTSW	7	98081087	missense	probably benign	0.00
R4222:Myo7a	UTSW	7	98073229	missense	possibly damaging	0.93
R4255:Myo7a	UTSW	7	98071964	missense	probably damaging	0.96
R4374:Myo7a	UTSW	7	98102674	missense	probably damaging	1.00
R4429:Myo7a	UTSW	7	98053188	missense	probably damaging	0.99
R4445:Myo7a	UTSW	7	98066404	missense	probably damaging	1.00
R4579:Myo7a	UTSW	7	98073193	missense	probably damaging	1.00
R4659:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R5073:Myo7a	UTSW	7	98073218	nonsense	probably null
R5138:Myo7a	UTSW	7	98083599	missense	probably damaging	1.00
R5566:Myo7a	UTSW	7	98064816	missense	possibly damaging	0.93
R5580:Myo7a	UTSW	7	98073160	missense	probably damaging	1.00
R6079:Myo7a	UTSW	7	98065790	nonsense	probably null
R6138:Myo7a	UTSW	7	98065790	nonsense	probably null
R6451:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6452:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6453:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6454:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6455:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6465:Myo7a	UTSW	7	98062680	missense	possibly damaging	0.95
R6653:Myo7a	UTSW	7	98054503	missense	probably damaging	0.96
R6709:Myo7a	UTSW	7	98054699	missense	probably damaging	1.00
R6917:Myo7a	UTSW	7	98095763	missense	possibly damaging	0.58
R7313:Myo7a	UTSW	7	98064195	missense	probably damaging	0.99
R7334:Myo7a	UTSW	7	98079366	missense	probably benign
R7356:Myo7a	UTSW	7	98102683	missense	probably benign	0.01
R7393:Myo7a	UTSW	7	98063699	missense	possibly damaging	0.91
R7422:Myo7a	UTSW	7	98051626	splice site	probably null
R7472:Myo7a	UTSW	7	98064793	missense	probably damaging	1.00
R7483:Myo7a	UTSW	7	98063674	missense	probably benign	0.07
R7526:Myo7a	UTSW	7	98085448	missense	possibly damaging	0.49
R7948:Myo7a	UTSW	7	98075029	missense	probably damaging	1.00
R8069:Myo7a	UTSW	7	98083626	nonsense	probably null
R8115:Myo7a	UTSW	7	98066446	missense	probably damaging	0.98
R8150:Myo7a	UTSW	7	98063639	missense	probably benign	0.19
R8265:Myo7a	UTSW	7	98085397	missense	probably benign	0.00
R8289:Myo7a	UTSW	7	98077169	missense	probably benign
R8298:Myo7a	UTSW	7	98098334	missense	probably damaging	1.00
R8518:Myo7a	UTSW	7	98091063	missense	possibly damaging	0.58
RF005:Myo7a	UTSW	7	98093617	missense	probably benign	0.42
U15987:Myo7a	UTSW	7	98065790	nonsense	probably null
X0028:Myo7a	UTSW	7	98065725	missense	probably damaging	1.00
X0058:Myo7a	UTSW	7	98062648	missense	probably benign	0.02
Z1176:Myo7a	UTSW	7	98095727	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98052226	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98085523	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTCCAGACAGAGGGATAGCACAG -3'
(R):5'- TAGGGTTCCAGACCAGAAGGGTTG -3'

Sequencing Primer
(F):5'- GGGCTGATAAAAGCTGGTTAC -3'
(R):5'- CCAGAAGGGTTGTGTGAGATG -3'

Posted On

2013-07-11